IMMUNOGENIC COMPOSITION, NUCLEIC ACID MOLECULE, VECTOR, INFECTIOUS VIRAL PARTICLE, TRANSGENIC MICROO

专利摘要:
immunogenic composition, nucleic acid molecule, vector, infectious viral particle, transgenic microorganism, composition, uses of at least one of the hbv portions, method of treating or preventing an hbv infection, method of inducing or stimulating an immune reaction and kit of parts The present invention provides a composition comprising hepatitis b virus (hbv) component(s) and which may be based on nucleic acids or polypeptides, as well as nucleic acid molecules and vectors encoding such component(s). (s) of hbv. it also refers to infectious viral particles and host cells that comprise such nucleic acid molecules or vectors. it also provides compositions and kits of parts comprising such nucleic acid molecules, vectors, infectious viral particles or host cells and their therapeutic use to prevent or treat hbv infections.
公开号:BR112012002628B1
申请号:R112012002628-3
申请日:2010-08-06
公开日:2021-09-08
发明作者:Perrine Martin；Doris Schmitt；Geneviève Inchauspe；Nathalie Silvestre
申请人:Transgene Sa；
IPC主号:

专利说明:

FIELD OF THE INVENTION
[001] The present invention relates to immunogenic compositions with component(s) of the hepatitis B virus (HBV) and which can be based on nucleic acids or polypeptides. Said immunogenic compositions can be used to stimulate or amplify an immunological reaction to HBV with the aim of providing a protective or therapeutic effect against HBV infections and any condition or disease caused by or associated with an HBV infection. The present invention also relates to expression vectors for expressing such component(s) of HBV and their prophylactic or therapeutic use. The present invention is of very special interest in the field of immunotherapy and more specifically for the treatment of patients infected with HBV, especially those with chronic infection. BACKGROUND OF THE INVENTION
[002] Hepatitis B is a major public health problem with more than 350 million people with chronic infection worldwide, 20 to 40% of whom are at risk of developing chronic liver disease, cirrhosis, and hepatocellular carcinoma. Despite the existence of effective preventive vaccines, hepatitis B virus (HBV) infection is still widespread in many countries, even developed, with an estimated 4.5 million new cases of infection per year worldwide. Contrary to the WHO recommendation, which is the implementation of universal vaccination, the coverage of complete preventive vaccination varies from 25% in Asia to 75% to 90% in Europe. Hepatitis B is currently the tenth leading cause of mortality (about one million deaths per year) and HBV-related liver cancer is the fifth most frequent cancer. The geographic division of HBV infections is uneven, with a prevalence of less than 1% in Western countries to more than 10% in Southeastern countries, most of Africa and equatorial South America. In areas with a high prevalence of chronic HBV carriers, vertical transmission from the infected mother to the newborn is the most frequent mode of contamination and almost always results in chronic hepatitis (90% of cases). This rate can be reduced to 15% through preventive vaccination of infected babies immediately after birth. In Western countries, infection is more likely to occur during adulthood through horizontal transmission through body fluids such as blood, semen, and saliva, resulting in acute, self-healing infection in 85% of patients, but chronic infection in 15% of cases.
[003] Hepatitis B virus (HBV) is a member of the hepadnavirides and primarily infects the liver, reproducing in hepatocytes. The infectious particles are called “Dane particles” from 42 to 45 nm, which consist of an outer lipoprotein envelope that contains three different surface proteins (HBs) and an inner nucleocapsid, whose important structural protein is the core protein (HBcAg) . Within the nucleocapsid is a single copy of the HBV genome linked to the viral polymerase protein (P). In addition to 42 to 45 nm virions, blood from patients infected with HBV contains 20 nm beads made of HBsAg and host-derived lipids that are released from infected cells. These spheres are found in greater numbers than virions by a factor of 104 to 106.
[004] The HBV genome is a relaxed circular partially double-stranded DNA of about 3200 nucleotides consisting of a full-length negative strand and a shorter positive strand. It contains four overlapping open reading frames (ORFs), C, S, P, and X. ORF C encodes the core protein (or HBcAg), a 183 amino acid long protein that makes up the nucleocapsid of HBV and a second found protein in patient serum during known virus replication with HBeAg which contains an N-terminal extension before the center and a part of HBcAg. The C-terminus of the core protein is very basic and contains four Arg-rich domains that are predicted to bind nucleic acids as well as several phosphorylation sites (the phosphorylation state of the core is associated with conformational changes in the capsid particle as described in Yu and Sommers, 1994, J. Virol., 68: 2965. The ORF encodes three surface proteins, all of which have the same C-terminus, but differ at their N-termini due to the presence of three in-frame ATG start codons that divide the S ORF into three regions, S (226 amino acids) , pre-S2 (55 amino acids) and pre-S1 (108 amino acids), respectively. Large surface antigen (L) protein is produced after translation initiation at the first ATG start codon and comprises 389 amino acid residues (pre S1-pre S2-S). The intermediate surface antigen protein (M) results from the translation of the S region and the pre-S2 region from the second onset ATG, while the 226 amino acid small surface antigen protein (S, also called HBsAg) results from translation of the S region starting at the third ATG start codon. HBV surface proteins are glycoproteins with carbohydrate side chains (glycans) linked by N-glycosidic bonds. The P ORF encodes viral polymerase and the X ORF contains a protein known as protein X, which is believed to be an activator of transcription.
[005] After virions enter hepatocytes via an as-yet-unknown receptor, the nucleocapsids transport the genomic HBV DNA to the center, where the relaxed circular DNA is converted to covalently closed circular DNA (cccDNA). cccDNA works as a template for the transcription of four viral RNAs, which are exported to the cytoplasm and used as mRNAs for the translation of HBV proteins. The longer (pre-genomic) RNA also functions as the HBV replication model, which occurs in nucleocapsids in the cytoplasm. Some of the polymerase and HBV DNA-containing capsids are then transported back to the center, where they release the newly generated relaxed circular DNA to form additional cccDNA. With a half-life longer than that of hepatocytes, cccDNA is responsible for the persistence of HBV. Other capsids are engulfed by grafting into the endoplasmic reticulum and secreted after passing through the Golgi complex.
[006] Several previous clinical and clinical studies have emphasized the importance of CD4+ and CD8+ T cell immune reactions for effective antiviral reaction (Ferrari et al, 1990, J. Immunol., 145: 3442; Penna et al, 1996, J. Clin Invest., 98: 1185; Penna et al, 1997, Hepatology, 25: 1022). This means that patients who recovered naturally from hepatitis B mounted sustained and multispecific reactions mediated by T helper (TH) and cytotoxic T lymphocytes (CTL) that are easily detectable in peripheral blood. Upon recognition of viral peptides, CTL obtain the ability to cure HBV-infected cells through non-cytopathic cytokine-mediated inhibition of HBV replication and/or kill them through perforin-Fas ligand and TNFα-mediated death processes . Both effector functions were observed during resolution of acute hepatitis B and this type 1 (Th1) T cell reaction persists after clinical recovery. It often coincides with an elevation of serum alanine aminotransferase (ALT) levels and the appearance of HBcAg-specific IgG and IgM. Anti-HBe and anti-HBs antibodies appear later and indicate a favorable outcome of infection. HBsAg-specific antibodies are neutralizing, mediate protective immunity, and persist throughout life after clinical recovery. Chronic HBV infections, however, are only rarely resolved by the immune system. When this occurs, viral release is associated with increased CTL activity and increased ALT levels caused by a destruction of infected hepatocytes by the immune system. The vast majority of patients with chronic infection, however, exhibit weak and transient CD4 and CD8 T cell immune responses that are antigenically restricted and ineffective for clearing viral infections, although individual HBV-specific T cell clones have been isolated and expanded from liver biopsies. The reason for this alteration in the effector functions of the cellular immune reaction in chronic hepatitis B is currently unknown. It has been shown, however, that functional T cell reactions can be partially restored in some patients when the viral load is below a threshold of 106 IU/ml (Webster et al, 2004, J. Virol. 78: 5707). These data are clearly encouraging and emphasize the need for immunomodulatory strategies capable of inducing an effective T cell reaction.
[007] Ideally, the treatment of chronic viral hepatitis B should first allow the suppression of HBV replication before irreversible liver damage, in order to eliminate the virus, prevent disease progression to cirrhosis or liver cancer, and increase the survival of patients. Conventional treatment of chronic hepatitis B includes pegylated interferon alpha (IFNa) and nucleoside and nucleotide analogues (NUCs) such as lamivudine and, more recently, entecavir, telbivudine, adefovir and tenofovir (EASL Clinical Practice Guidelines: Management of Chronic Hepatitis B, 2009). IFNa is a potent antiviral molecule, in which inhibition of viral replication, however, causes serious side effects in only 25-30% of patients. NUCs act as competitive inhibitors of HBV polymerase designed to inhibit the reverse transcription of pre-genomic RNA in the negative DNA lineage and then in the double-stranded viral DNA. They limit the formation of new virions but are ineffective in eliminating the supercoiled cccDNA hidden in the nucleus of infected hepatocytes that is a source of new offspring viruses. This may explain why the effectiveness of NUC is temporary and viral rebound occurs immediately after the end of treatment, requiring patients to remain on treatment for life. Furthermore, long-term efficacy is also limited due to the emergence of resistant mutant HBV (over 24% after one year and about 66% after four years of lamivudine treatment as discussed in Leung et al, 2001, Hepatology 33: 1527), although newer NUCs (entecavir, telbivudine, and tenofovir) demonstrated much fewer occurrences of drug-resistant HBV mutants, while increasing HBV DNA suppression. Long-term treatment data with these new drugs are, however, limited and this higher efficacy was not correlated with a significantly higher rate of HBs seroconversion.
[008] In addition to antiviral therapies, efforts are currently being made to develop supplemental therapies aimed at enhancing host immune reactions, specifically those mediated by cytotoxic T and helper T lymphocytes. A vast majority of existing immunotherapeutic approaches have focused on the use of HBV surface protein(s), pre-S1 and/or pre-S2 (Smith et al, 1983, Nature 302: 490; Lubeck et al, 1989, Proc. Natl. Acad. Sci. USA 86: 6763; Adkins et al, 1998, BioDrugs 10: 137; Loirat et al, 2000, J. Immunol. 165: 4748; Funuy-Ren et al, 2003, J. Med. Virol. 71: 376; Kasaks et al, 2004, J. Gen. Virol. 85: 2665; Xiangming Li et al, 2005, Intern. Immunol. 17: 1293; Mancini-Bourguine et al, 2006, Vaccine 24: 4482; Vandepapeliere et al, 2007, Vaccine, 25: 8585). Encouraging results were obtained regarding the stimulation of immune reactions. Mancini-Bourguine et al (2006, Vaccine 24: 4482) reported the induction and/or re-call of T cell reactions in patients with chronic HBV infection who received injection of a pre-S2 S-encoding DNA vaccine, which it is a good indication that the immune system is still operational in these patients.
[009] HBcAg has also been used as an immunogen (Yi-Ping Xing et al, 2005, World J. Gastro. 11: 4583), as well as chimeric HBcAg capsids that contain exogenous epitopes on their surface (WO 92/11368; WO 92/11368; WO 00/32625; Koletzki et al, 1997, J. Gen. Virol. 78: 2049). The most promising site for insertion of epitopes from the standpoint of immunogenicity appears to be the site of an external circuit predicted to lie on the surface of HBcAg near position 80 (Argos et al, 1988, EMBO J. 7: 819). Schodel et al (1992, J. Virol. 66: 106) and Borisova et al (1993, J. Virol. 67: 3696) were able to insert pre-S1 and HBsAg epitopes into this region and reported successful immunization with the chimeric particles .
[010] Possible multivalent vaccines designed to simultaneously target several HBV antigens have also been researched. Notably, it has been shown that a multi-epitope DNA vaccine encoding a fusion polypeptide of diverse epitopes of cytotoxic T lymphocytes (CTL) and helper T lymphocytes (HTL) present in envelope, core and polymerase proteins allows for diverse CTL reactions and HTL in preclinical mouse models (Depla et al, 2008, J. Virol. 82: 435). Several vaccine formulations have been developed based on a mixture of DNA plasmids encoding HBsAg, HBcAg and HBV polymerase (WO 2005/056051; WO 2008/020656) and have demonstrated specific anti-HBV humoral and cellular reactions in a transgenic mouse model of chronic hepatitis B (Chae Young Kim et al, 2008, Exp. Mol. Medicine 40: 669). Phase I clinical trials were initiated in South Korea in HBV carriers in combination with lamivudine treatment (Yang et al, 2006, Gene Ther. 13: 1110).
[011] Consequently, there is still a need for alternative immunotherapeutic approaches to more potently and effectively induce immune reactions, especially cell-mediated immune reactions, in an individual in need thereof such as a patient with chronic HBV infection.
[012] There is still a need to provide a vector-based composition capable of stably and sustainably expressing the HBV antigen.
[013] This technical problem is solved by providing the realizations as defined in the claims.
[014] Other additional aspects, features and advantages of the present invention will be apparent from the following description of the currently preferred embodiments of the present invention. These achievements are provided for description purposes. BRIEF DESCRIPTION OF THE INVENTION
[015] Consequently, in a first aspect, the present invention provides an immunogenic composition comprising at least one polypeptide or a nucleic acid molecule encoding said at least one polypeptide, wherein said at least one polypeptide is selected from from the group consisting of: (i) a polymerase portion comprising at least 450 amino acid residues of a polymerase protein originating from a first HBV virus; (ii) a core portion comprising at least 100 amino acid residues of a core protein originating from a second HBV virus; and (iii) an env portion comprising one or more immunogenic domains from 15 to 100 consecutive amino acid residues of an HBsAg protein originating from a third HBV virus; or any combination of said polymerase portion, core portion, env portion, wherein said nucleic acid molecule encodes said polymerase portion, said nucleic acid molecule encodes said core portion and/or said nucleic acid molecule encodes said env portion. DEFINITIONS
[016] As used herein throughout this application, the terms "one" and "an" are used in the sense of "at least one", "at least one first", "one or more" or " a series” of the compounds or steps indicated, unless the context indicates otherwise. The expression “a cell”, for example, includes a series of cells, including one of their mixtures.
[017] The term "and/or", whenever used herein, includes the meaning of "and", "or" and "all or any other combination of the elements connected by said term".
[018] The expression "about" or "approximately", as used herein, indicates up to 10%, preferably up to 8% and more preferably up to 5% of a given value or range.
[019] As used herein, when used to define products, compositions and methods, the expressions "which comprises" (and any of its forms, such as "comprises" and "comprises"), "which possesses" (and any of its forms, such as "possess" and "possess"), "which includes" (and any of its forms, such as "includes" and "includes") or "which contains" (and any of its forms, such as “contains” and “contains”) have open ends and do not exclude elements or additional method steps not indicated. “Consisting essentially of” indicates the exclusion of other components or steps of any essential meaning. Thus, a composition consisting essentially of the indicated components would not exclude trace amounts of pharmaceutically acceptable carriers and contaminants. “Consisting of” indicates the exclusion of more than trace elements from other components or steps. A polypeptide, for example, “consists of” an amino acid sequence when the polypeptide does not contain any amino acids other than the indicated amino acid sequence. A polypeptide "consists essentially of" an amino acid sequence when that amino acid sequence is present with eventually only a few additional amino acid residues. A polypeptide "comprises" an amino acid sequence when the amino acid sequence is at least a part of the final amino acid sequence of the polypeptide. This polypeptide can contain up to a few hundred additional amino acid residues.
[020] The terms “amino acids”, “residues” and “amino acid residues” are synonymous and encompass natural amino acids as well as amino acid analogues (such as unnatural, synthetic and modified amino acids, including optical D or L isomers).
[021] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to designate polymers of amino acid residues that comprise nine or more amino acids linked via peptide bonds. The polymer can be linear, branched or cyclic and can comprise naturally occurring and/or amino acid analogs and can be interrupted by non-amino acids. As a general indication, if the amino acid polymer is long (such as more than fifty amino acid residues), it is preferably called a polypeptide or protein, while if it is fifty amino acids long or less, it is called a "peptide".
[022] Within the context of the present invention, the terms "nucleic acid", "nucleic acid molecule", "polynucleotide" and "nucleotide sequence" are used interchangeably and define a polymer of any length of polydeoxyribonucleotides (DNA) (such as cDNA, genomic DNA, plasmids, vectors, viral genomes, isolated DNA, probes, primers and any mixtures thereof) or polyribonucleotide (RNA) molecules (such as mRNA, nonsense RNA) or mixed polyribopolydeoxyribonucleotides. They encompass natural or synthetic polynucleotides, linear or circular, single-stranded or double-stranded. In addition, a polynucleotide may comprise non-naturally occurring nucleotides, such as methylated nucleotides and nucleotide analogues (see US 5,525,711, US 4,711,955 or EPA 302,175 as examples of modifications) and may be interrupted by non-nucleotide components. When present, nucleotide modifications can be imposed before or after polymerization.
[023] As used herein, the term "immunogenic composition" means a formulation comprising one, two, three, four or more components described below (such as the polymerase portion, central portion, env portion, acid molecule nucleic acid encoding the polymerase portion, the nucleic acid molecule encoding the core portion and/or the nucleic acid molecule encoding the env portion) and, optionally, other components (such as adjuvant, vehicle, diluent etc.). The immunogenic composition according to the present invention will typically be in a form that is capable of being administered to a host organism and induces a protective or therapeutic immunological reaction sufficient to induce or stimulate anti-HBV immunity, which results in such therapeutic benefit. how to prevent an HBV infection, reduce and/or improve at least one condition caused by or associated with an HBV infection (such as reducing viral load, reducing or delaying the risk of liver damage such as cirrhosis or liver cancer, increase liver history etc.) and/or reduce the level of HBeAg or HBsAg in serum or both and/or induce HBe seroconversion, HBs seroconversion or both and/or increase the efficacy of another anti-HBV therapy or prophylaxis. Upon introduction into a host organism, the immunogenic composition according to the present invention is capable of eliciting an immunological reaction that includes, but is not limited to, the production of antibodies and/or cytokines and/or the activation of cytotoxic T cells, B, T lymphocytes, antigen presenting cells, helper T cells, dendritic cells, NK cells, which generate the production of innate immune reaction and/or specific humoral and/or cellular immune reactions against at least one HBV epitope/antigen.
[024] "Immunogenic domain" means a structural portion of an HBV protein capable of being bound by an antibody or T cell receptor. Typically, this immunogenic domain particularly contains one or more B and/or T epitopes. CTL, TH or TH epitopes both are involved in recognition by a specific antibody or in the context of an MHC (Major Histocompatibility Complex) by T cell receptors. An "epitope" corresponds to a minimal peptide motif (usually a set of nine to eleven amino acid residues) which together form a site recognized by an antibody, T cell receptor or HLA molecule. These residues can be consecutive (linear epitope) or not (a conformation epitope that includes residues that are not immediately adjacent to each other). It is generally believed that the recognition of a T cell epitope by a T cell is accomplished through a mechanism in which T cells recognize fragments of antigen peptides that are bound to class I or class II MHC molecules expressed on antigen-presenting cells.
[025] As used herein, "HBV" and "hepatitis B virus" are used interchangeably and designate any member of the hepadnavirids (see, for example, Ganem and Schneider in Hepadnaviridae (2001), The Viruses and their Replication (pp. 29232969), Knipe, DM et al, Eds., Fields Virology, fourth edition, Philadelphia, Lippincott Williams & Wilkins or subsequent edition). Extensive phylogenetic analyzes have generated classification of hepatitis B virus into eight important genotypes (A through H), which exhibit sequence divergence of at least 8%. The various HBV genotypes exhibit distinct geographic distribution and may exhibit heterogeneous disease symptoms and/or clinical outcomes. The various HBVs have been classified into nine different subtypes (ayw1, ayw2, ayw3, ayw4, ayr, adw2, adw4, adrq+ and adqr-) with regard to serology associated with HBsAg (see analysis by Mamum-Al Mahtab et al, 2008, Hepatobiliary Pancrease Dis. Int. 5: 457; Schaeffer, 2007, World Gastroenterol. 7: 14; Norder et al, 1993, J. Gen. Virol. 74: 1341). Each genotype and serotype encompasses different HBV strains and isolates. An isolate corresponds to a specific virus isolated from a specific source of HBV (such as a patient sample or other biological HBV reservoir), whereas a strain encompasses several isolates that are very close to each other in terms of genomic sequences.
[026] Several HBVs suitable for use in the context of the present invention are described in the art, especially in Genbank. Examples of HBV of genotype A include, without limitation, the HB-JI444AF isolate and the HB-JI444A strain (accession number AP007263). Examples of HBV of genotype B include, without limitation, clone pJDW233 (accession number D00329), isolate HBV/14611 (accession number AF121243), HBV-B1 identified in 2001 by Hou et al (GenBank accession no. AF282917.1 ), HBV strain Whutj-37 (GenBank accession no. AY2933309.1) identified by Zhang et al (2005, Arch. Virol. 150, 721741), Chinese HBV strain GDH1 identified by He et al (GenBank accession no. AY766463.1) and the HBV 57-1 adw subtype isolate identified by Jiang et al (GenBank Accession No. AY518556.1). Examples of HBV of genotype C include, without limitation, isolate AH-1-ON980424 (accession number AB113879), lineage HCC-3-TT (accession number AB113877), HBV isolate SWT3.3 identified by Fang et al (accession GenBank No. EU916241.1), HBV H85 isolate identified by Zhu et al (GenBank accession no. AY306136.1), HBV C1248 lineage identified by Tu et al (GenBank accession no. DQ975272.1), isolated from HBV CHN -H155 (GenBank accession no. DQ478901.1) identified by Wang et al (2007, J. Viral Hepat. 14, 426-434) and HBV GZ28-1 isolate identified by Zhou et al (GenBank accession no. EF688062). Examples of HBV of genotype D include, without limitation, isolates KAMCHATKA27 (accession number AB188243), ALTAY136 (accession number AB188245) and Y07587 described in Stoll-Becker et al (1997, J. Virol. 71:5399) and available from Genbank with accession number Y07587, as well as the HBV isolate described with accession number AB267090. Examples of HBV of genotype E include, without limitation, the HB-JI411F isolate and the HB-JI411 strain (accession number AP007262). Examples of HBV of genotype F include, without limitation, isolates HBV-BL597 (accession number AB214516) and HBV-BL592 (accession number AB166850). Examples of HBV of the G genotype include, without limitation, the HB-JI444GF isolate and the HB-JI444G strain (accession number AP007264). Examples of HBV of genotype H include, without limitation, HBV isolate ST0404 (accession number AB298362) and isolate HB-JI260F and lineage HB-JI260 (accession number AP007261). The present invention is not limited, however, to these examples of HBV. In fact, nucleotide and amino acid sequences can vary between different HBV isolates and genotypes and such natural genetic variation is included within the scope of the present invention, as well as unnatural modification(s) such as those described below.
[027] As used herein, "native HBV protein" means a protein, polypeptide or peptide (such as polymerase protein, core protein or HBsAg etc.) that can be found, isolated or obtained from a source of HBV in nature as distinct from one artificially modified or altered by man in the laboratory. Therefore, this term would include naturally occurring HBV protein polypeptides, unless otherwise specified. These sources in nature include biological samples (such as blood, plasma, serum, semen, saliva, tissue sections, biopsy sample etc.) taken from a patient infected or exposed to HBV, cultured cells (such as HepG2.2.15 , HuH6-C15 (Sureau et al, 1986, Cell 47: 37; Sells et al, 1987, Proc. Natl. Acad. Sci. 84 (4): 1005); HuH7.TA61 or HuH7.TA62 (Sun et al, 2006, J. Hepatol. 45(5): 636), tissue cultures as well as recombinant materials Recombinant materials include, without limitation, HBV isolate (as available from depositary institutions), HBV genome, cDNA libraries or Genomic RNA, plasmids that contain the HBV genome or fragments thereof, or any prior art vector known to include these elements.
[028] The nucleotide sequences encoding the various HBV proteins can be found in specialized databases (such as those mentioned above) and in the literature (see, for example, Valenzuela et al, 1980, The Nucleotide Sequence of the Hepatitis B Viral Genome and the Identification of the Major Viral Genes (p. 5770) in Animal Virus Genetics; Eds. B. Fields et al; Academic Press Inc., New York and Vaudin et al, 1988, J. Gen. Virol. : 1383). Representative examples of native polymerase, core and HBsAg polypeptides are as defined in SEQ ID NO. 1 to 3, respectively (SEQ ID NO. 1 provides the amino acid sequence of the native polymerase protein of HBV isolate Y07587, SEQ ID NO. 2 provides the amino acid sequence of the native core protein of HBV isolate Y07587 and SEQ ID NO: 3 provides the amino acid sequence of the native env (HBsAg) of HBV isolate Y07587). Nucleotide sequences encoding the native, core and HBsAg polymerase of HBV Y07587 are shown for illustrative purposes in SEQ ID Nos. 4, 5 and 6, respectively. As discussed above, however, HBv proteins are not limited to these sequence examples and genetic variation is included within the scope of the present invention.
[029] As used herein, the term "portion" (such as polymerase, core and/or env portions) designates a protein, polypeptide or peptide that originates from a native HBV protein, polypeptide or peptide after its modification or artificial alteration by man in the laboratory as described herein. The term "modified" encompasses deletion, substitution or addition of one or more nucleotide/amino acid residues, any combination of these possibilities (such as degeneration of the native nucleotide sequence to reduce homology between the HBV sequences encoded by the composition according to the present invention, introduction of appropriate restriction sites) as well as unnatural arrangements (such as fusion between two or more HBV proteins, polypeptides, peptides or moieties). When several modifications are contemplated, they may refer to consecutive residues and/or non-consecutive residues. Modification(s) can be generated by a number of ways known to those skilled in the art, such as site-directed mutagenesis (using, for example, the Sculptor® in vitro mutagenesis system by Amersham, Les Ullis, France), PCR mutagenesis, DNA switching and by means of chemical synthetic methods (which results, for example, in a synthetic nucleic acid molecule). The modification(s) contemplated by the present invention encompasses silent modifications that do not alter the amino acid sequence of the encoded HBV polypeptides, as well as modifications that are translated into the encoded polypeptide, resulting in an amino acid sequence modified compared to the corresponding native. The term "originates" (or originates) is used to identify the original source of a molecule, but is not intended to limit the method by which the molecule is made, which may be, for example, by means of chemical synthesis or recombinant means.
[030] Preferably, each of the HBV portions in use in the present invention retains a high degree of amino acid sequence identity with the corresponding native HBV protein, either along the full-length protein or its portion(s)( s). The percentage of identity between two polypeptides is a function of the number of identical positions shared by the sequences, considering the number of spaces that need to be introduced for optimal alignment and the length of each space. Various computer programs and mathematical algorithms are available in the art for determining percent identity between amino acid sequences, such as the BLAST program (such as Altschul et al, 1997, Nucleic Acid Res. 25: 3389; Altschul et al, 2005, FEBS J. 272: 5101) available from the NCBI. The same can apply to nucleotide sequences. Nucleotide sequence homology programs are also available in specialized databases (Genbank or the Wisconsin Sequence Analysis Package) such as BESTFIT, FASTA and GAP programs.
[031] In addition to the modifications described below, for example (such as reduced enzymatic activities etc.), any and all portions of HBV composed or encoded by the composition according to the present invention can be modified so as to be representative of a genotype is specific and therefore comprises an amino acid sequence corresponding to a consensus sequence or close to the consensus that is typically determined after aligning sequences of various HBV polypeptides of a specific genotype.
[032] The term "combination", as used herein, means any type of combination between at least two of the components composed or encoded by the immunogenic composition according to the present invention and any possible arrangement of the various components with specific preference for two or three of the aforementioned components. This encompasses mixtures of two or more polypeptides, mixtures of two or more vectors/nucleic acid molecules, mixtures of one or more polypeptides and one or more vectors/nucleic acid molecules, as well as fusion of two or more nucleic acid molecules, in order to provide a single polypeptide chain that contains two or more portions of HBV (such as unnatural arrangement).
[033] In a preferred embodiment, the immunogenic composition according to the present invention comprises a combination of at least two of said polymerase portion, central portion, env portion or at least two of said nucleic acid molecules encoding the said polymerase portion, said nucleic acid molecule encoding said core portion, and/or said nucleic acid molecule encoding said env portion. A particularly preferred composition according to the present invention is selected from the group consisting of (i) a composition comprising a combination of a polymerase moiety and a core moiety as defined herein or a combination of nucleic acid molecules which encode said polymerase portion and said central portion; (ii) a composition comprising a combination of a core portion and an env portion as defined herein or a combination of nucleic acid molecules encoding said core portion and said env portion; and (iii) a composition comprising a combination of a polymerase portion, a core portion and an env portion as defined herein or a combination of nucleic acid molecules encoding said polymerase portion, said core portion and said portion env.
[034] The term "fusion" or "fusion protein", as used herein, designates the combination of at least two polypeptides (or their fragment(s)) in a single polypeptide chain. Preferably, the fusion between the various polypeptides is carried out by genetic means, that is, by means of in-frame fusion of the nucleotide sequences that encode each of the aforementioned polypeptides. By "fused in frame", it is meant that expression of the fused coding sequences results in a single protein with no translation terminus between each of the fused polypeptides. The fusion can be direct (that is, with no additional amino acid residues in between) or through a linker. The presence of a linker can facilitate the formation, folding and/or correct functioning of the fusion protein. The present invention is not limited by the shape, size or number of binding sequences employed and multiple copies of a binding sequence may be inserted at the junction between the fused polypeptides. Suitable linkers according to the present invention are from three to thirty amino acids in length and are composed of repeats of amino acid residues such as glycine, serine, threonine, asparagine, alanine and/or proline (see, for example, Wiederrecht et al. , 1988, Cell 54, 841; Aumailly et al, 1990, FEBS Lett. 262, 82; and Dekker et al, 1993, Nature 362, 852), such as Ser-Gly-Ser or Gly-Ser-Gly-Ser linker -Gly.
[035] As used herein, the expression "heterologous hydrophobic sequence" designates a peptide of hydrophobic nature (which contains a high number of hydrophobic amino acid residues such as Val, Leu, Ile, Met, Phe, Tyr and Trp residues). "Heterologous" means a sequence that is exogenous to the native HBV protein, polypeptide or peptide from which the selected HBV portion originates. It may be an exogenous peptide to an HBV virus (such as a peptide from a measles or rabies virus) or an HBV virus peptide but not in a position not normally found within the viral genome. The heterologous hydrophobic sequence can be fused in-frame at the N-terminus, C-terminus or within an HBV moiety and can play a role in polypeptide trafficking, facilitate polypeptide production or purification, and prolong half-life, among other things . Suitable heterologous hydrophobic sequences according to the present invention are fifteen to one hundred amino acids long and contain a highly hydrophobic domain.
[036] The term "vector", as used herein, designates expression and non-expression vectors and includes viral and non-viral vectors, including extrachromosomal vectors (such as plasmids with multiple copies) and integral vectors designed for incorporation into ) host chromosome(s). Particularly important in the context of the present invention are vectors for transferring nucleic acid molecule(s) into a viral genome (so-called transfer vectors), vectors for use in immunotherapy (ie, vectors that are capable of delivering the acid molecules to a host organism), as well as expression vectors for use in various expression systems or in a host organism.
[037] As used herein, the expression "viral vector" encompasses vector DNA as well as viral particles generated from it. Viral vectors can be replication competent or they can be genetically incapacitated so that they are replication defective or impaired. The term "replication-competent" as used herein encompasses replication-selective and conditionally replicating viral vectors that are designed for better or selective replication in specific host cells (such as tumor cells).
[038] As used herein, the expression "regulatory sequence" means any sequence that allows, favors or modulates the expression of a nucleic acid molecule in a given host cell or organism, including replication, duplication, transcription, division, translation, stability and/or transport of the nucleic acid or one of its derivatives (i.e., mRNA) into a host organism or cell.
[039] As used herein, the expression "host cell" should be broadly understood without any limitation referring to the specific organization in tissues, organs or isolated cells. These cells can be a unique cell type or a group of different cell types and encompass bacteria, lower and higher eukaryotic cells as well as cultured cell lines, primary cells and proliferating cells. This term includes cells that may be or were the recipient of the composition(s), nucleic acid molecule(s), vector(s) or infectious viral particle(s) hereunder. invention and the offspring of these cells.
[040] The expression “host organism” designates a vertebrate, particularly a member of the mammal species and especially domestic animals, farm animals, sport animals and primates, including humans. Preferably, the host organism is a patient suffering from chronic HBV infection. The infecting HBV may be of the same genotype or serotype as at least one of the first, second or third HBV in use in the present invention.
[041] As used herein, the term "isolated" means a protein, polypeptide, peptide, nucleic acid molecule, host cell or virus that is removed from its natural environment (ie, separated from at least one other component by the which is naturally associated).
[042] As used herein, "therapeutically effective amount" is a dose sufficient to alleviate one or more symptoms normally associated with an HBV infection or any disease or condition caused by or associated with an HBV infection. With reference to prophylactic use, this expression indicates a dose sufficient to prevent or delay the onset of an HBV infection. "Therapeutic" compositions are designed and administered to a host organism already infected with HBV with the aim of reducing or ameliorating at least one disease or condition caused by said or associated HBV infection, possibly in combination with one or more conventional therapeutic modalities as described herein (such as treatment with nucleoside or nucleotide analogues). A therapeutically effective amount to induce an immune reaction might be, for example, the amount needed to cause activation of the immune system (resulting, for example, in the development of an anti-HBV reaction). The term "cancer" encompasses any cancerous conditions, including diffuse or localized tumors, metastases, cancerous polyps and preneoplastic lesions (such as cirrhosis).
[043] As used herein, "pharmaceutically acceptable carrier" is intended to include any and all vehicle, solvent, diluent, excipient, adjuvant, dispersion medium, coating, antibacterial and antifungal agent, absorption delaying agent and the like, compatible with pharmaceutical administration.
[044] According to the present invention, said polymerase, core and/or env portions composed or encoded by the composition according to the present invention may originate independently of any currently identified HBV genotype, strain or isolate, such as described above with respect to the term “HBV”. Furthermore, each of the polymerase, core, and env moieties may originate from a corresponding native HBV protein or from a modified HBV polypeptide (such as modified to be representative of a specific genotype). In this way, the first, second and third HBV viruses from which the polymerase, central and env portions composed or encoded by the composition according to the present invention originate can be independently of the same genotype or of different genotypes, serotypes and/or isolates . The use of HBV moieties originating from two or three different HBV genotypes allows, for example, to provide protection against a wider range of HBV genotypes.
[045] In one embodiment, it may be interesting to adapt the immunogenic composition according to the present invention to a specific geographic region, using at least a portion of HBV from HBV genotype(s) that is (are) endemic in that region. For illustrative purposes, genotypes A and C are the most prevalent in the United States, while patients from Western European countries are mainly infected with genotypes A and D and those from the Mediterranean basin with genotype D. Limited data from India suggest that genotypes A and D are the most common in India. On the other hand, genotypes B and C are the most prevalent in China. A composition according to the present invention intended for European countries may comprise, for example, a polymerase portion originating from genotype A and central and env portions originating from genotype D or vice versa. Alternatively, the polymerase and core portions may be from genotype A and the env portion from genotype D. As another example, a composition according to the present invention intended for European countries and the United States may comprise polymerase, core and env portions which originate independently from genotype A, C and D. On the other hand, a composition according to the present invention destined for China may comprise or encode polymerase, core and env moieties that originate independently from genotype B and/or Ç.
[046] One can also adapt the immunogenic composition according to the present invention to the population of patients to be treated. Genotype A, for example, is more common among American whites and African Americans and those with sexually acquired HBV infections, while genotypes B and C, on the other hand, are common among Asian North American, born patients. in Asia and those with mother-to-child transmission of HBV infection. HBV genotypes have also been associated with different clinical outcomes (Schaeffer et al, 2005, J. Viral. Hepatitis 12: 111), in which genotypes D and F are associated with more severe disease progression and a worse prognosis than genotype A (Sanchez-Tapias et al, 2002, Gastroenterology 123: 1848). It is within the scope of those skilled in the art to adapt the composition according to the present invention according to the population and/or geographic region to be treated by selecting genotypes, serotypes, strains and/or HBV isolates.
[047] According to an advantageous embodiment, at least two of the first, second and third HBV viruses, preferably all, are of the same HBV genotype and particularly of genotype D. Regardless, they can originate from the same isolate, with a specific preference for the first, second and third HBV viruses that are from HBV isolate Y07587. Preferably, the polymerase portion in use in the present invention comprises an amino acid sequence which exhibits at least 80% identity, conveniently at least 85% identity, preferably at least 90% identity, more preferably at least 95% identity and, most preferably, 100% identity with the amino acid sequence shown in SEQ ID No. 1 or portion(s) thereof which comprises at least 450 amino acid residues. Alternatively or in combination, the central portion for use in the present invention comprises an amino acid sequence which exhibits at least 80% identity, conveniently at least 85% identity, preferably at least 90% identity, more preferably at least 95% of identity, and preferably still greater, 100% identity with the amino acid sequence shown in SEQ ID No. 2 or portion(s) thereof comprising at least one hundred amino acid residues. Alternatively or in combination, the one or more immunogenic domains of the env portion in use in the present invention comprise(s) an amino acid sequence which exhibits at least 80% identity, conveniently at least 85% identity, preferably at least 90% identity identity, more preferably at least 95% identity, and most preferably 100% identity to portion(s) of fifteen to one hundred amino acid residues in the amino acid sequence shown in SEQ ID NO:3. POLYMERASE PORTION:
[048] According to one embodiment, the polymerase portion composed or encoded by the composition according to the present invention is modified compared to the corresponding native HBV polymerase.
[049] An appropriate modification is the truncation of at least twenty amino acid residues and at most 335 amino acid residues normally present at the N-terminus of a native HBV polymerase. This modification is particularly relevant for compositions according to the present invention which also comprise a second polypeptide, in order to reduce or exclude overlapping portions between the polymerase and core portions. It is well within the skill of those skilled in the art to adapt the truncation to the composition according to the present invention within the indicated range of at least twenty amino acid residues and at most 335 amino acid residues. With respect to native HBV polymerase, the polymerase portion used in the context of the present invention is conveniently truncated by at least thirty amino acid residues and at most two hundred amino acid residues, desirably at least 35 amino acid residues and at most one hundred amino acid residues, preferably at least forty amino acid residues and at most sixty amino acid residues, and more preferably at least 45 and at most 50 amino acid residues, with special preference for a truncation that includes the first 47 or 46 amino acid residues after the initiating Met residue located at the N-terminus of a native HBV polymerase. Preferably, the truncation extends from position 1 (Met primer) or 2 to position 47 of SEQ ID No. 1.
[050] A preferred embodiment relates to a polymerase portion comprising an amino acid sequence that exhibits at least 80% identity, conveniently at least 85% identity, preferably at least 90% identity, more preferably at least 95% identity, and preferably still greater, 100% identity to the portion of the amino acid sequence shown in SEQ ID NO: 1 which extends from approximately position 48 to approximately position 832; and, preferably still more, to a polymerase portion comprising an amino acid sequence which exhibits at least 80% identity, conveniently at least 85% identity, preferably at least 90% identity, more preferably at least 95% of identity, and preferably still greater, 100% identity with the amino acid sequence shown in SEQ ID NO:7.
[051] Alternatively or in combination, the polymerase moiety in use in the present invention is modified so as to exhibit a reduced reverse transcriptase (RTase) enzyme activity relative to a native HBV polymerase. Conveniently, the mentioned reduction of RTase activity is provided by one or more mutations in the domain responsible for the enzymatic activity of RTase.
[052] The functional and structural organization of HBV polymerases has been investigated nearly twenty years ago (see, for example, Radziwill et al, 1990, J. Virol. 64: 613). They are multifunctional proteins with three functional domains that catalyze the main steps of HBV replication (primer formation, DNA synthesis and removal of RNA templates) and a non-essential spacer that are arranged in the following order: - the first domain that extends from position 1 to approximately position 177 is responsible for HBV terminal protein activity; - the spacer is located from approximately position 178 to approximately position 335; - the DNA polymerase domain extending from approximately position 336 to approximately position 679 is responsible for RTase activity; and - the H domain of RNase from approximately position 680 to the C-terminus (approximately position 832) is involved in the H activity of RNase.
[053] Four residues were involved in RTase activity, forming a "YMDD" motif (for Tyr, Met, Asp and Asp residues) generally present from approximately position 538 to approximately position 541 of a native HBV polymerase (corresponding, for example, at positions 538, 539, 540 and 541 in SEQ ID No. 1 and at positions 492, 493, 494 and 495 in SEQ ID No. 7) and the present invention encompasses any mutation(s) therein. motif or elsewhere in the RTase domain that correlates to a significant reduction (ie, at least a ten-fold reduction) or ablation of RTase activity while retaining immunogenic properties. Representative examples of suitable RTase-deficient polymerase mutants are described in the literature, such as in Radziwill et al (1990, J. Virol. 64: 613), in Bartenschlager et al (1990, J. Virol. 64: 5324) and in Jeong et al (1996, Biochem. Bioph. Res. Commun. 223 (2):264). Preferably, the polymerase portion in use in the present invention comprises replacing the first Asp residue of the YMDD motif (corresponding to position 540 in SEQ ID No. 1 and position 494 of SEQ ID No. 7) or the amino acid residue located in an equivalent position in a native HBV polymerase to any amino acid residue other than Asp, with special preference for a substitution for a His residue (D540H mutation). Reduction or ablation of RTase activity can be performed using assays well known in the art (such as the endogenous polymerase assays described in Radziwill et al, 1990, J. Virol. 64: 613).
[054] Alternatively or in combination, the polymerase moiety in use in the present invention is modified so as to exhibit reduced RNase H enzymatic activity relative to a native HBV polymerase. Conveniently, the aforementioned reduction in RNase H activity is provided by one or more mutations in the domain responsible for the enzymatic activity of RNase H. As discussed above, the functional domain involved in the activity of RNase H has been mapped to the C-terminal portion of the polymerase of HBV, more specifically from position 680 to C-terminal position 832 and the present invention encompasses any mutation(s) in this domain that correlates with a significant reduction (i.e., at least ten-fold reduction) or ablation of RNase H activity and that it is not detrimental to immunogenic properties. Representative examples of suitable RNase H-deficient polymerase mutants are described in the literature, such as in Radziwill et al (1990, J. Virol. 64: 613), in Bartenschlager et al (1990, J. Virol. 64: 5324) . Preferably, the polymerase portion in use in the present invention comprises replacing the Glu residue corresponding to position 718 in SEQ ID No. 1 and position 672 of SEQ ID No. 7 or the amino acid residue located at an equivalent position in a polymerase of native HBV to any amino acid residue other than Glu, with special preference for a substitution for a His residue (E718H mutation). Reduction or ablation of RNase H activity can be performed using assays well known in the art (such as in vitro RNase H activity assays or DNA-RNA joint molecule analysis described in Radziwill et al, 1990, J. Virol. 64: 613 or in Lee et al, 1997, Biochem. Bioph. Res. Commun. 233 (2): 401).
[055] Preferably, the polymerase portion in use in the present invention undergoes mutation in order to reduce or perform ablation of the activities of RTase and RNase and comprises the modifications discussed above with respect to these enzymatic functions, with special preference for the mutations D540H and E718H .
[056] A preferred embodiment of the present invention relates to a polymerase portion comprising, alternatively consists essentially or alternatively consists of an amino acid sequence that exhibits at least 80% identity, conveniently at least 85% identity, preferably by the minus 90% identity, more preferably at least 95% identity, and most preferably 100% identity to the amino acid sequence shown in SEQ ID No. 8 or to the amino acid sequence shown in SEQ ID No. 8 7 with the replacement of the Asp residue at position 494 by a His residue and the replacement of the Glu residue at position 672 by a His residue.
[057] In another preferred embodiment, the polymerase portion in use in the present invention is fused in frame with heterologous hydrophobic sequence(s) in order to increase the synthesis and/or stability and/or presentation in the surface of host cells expressing and/or presenting to host MHC class I and/or class II MHC antigens. Appropriate heterologous hydrophobic sequences include sequences such as signal and/or transmembrane peptides, allowing to target the polymerase moiety in the secretion process. Such peptides are known in the art. Briefly, signal peptides are usually present at the N-terminus of secreted or membrane-presented polypeptides and initiate their passage to the endoplasmic reticulum (ER). They comprise thirteen to 35 essentially hydrophobic amino acids that are then removed by a specific ER-localized endopeptidase to generate the mature polypeptide. Transmembrane peptides are typically highly hydrophobic in nature and serve to anchor the polypeptides to the cell membrane (see, for example, Branden and Tooze, 1991, Introduction to Protein Structure, pp. 202-214, New York, Garland; WO 99/03885) . The choice of signal and/or transmembrane peptides that can be used in the context of the present invention is wide. They can be obtained from any secreted and/or membrane-anchored polypeptide (such as viral or cellular polypeptides), such as those from immunoglobulins, tissue plasminogen activator, insulin, rabies glycoprotein, HIV virus envelope glycoprotein, or the measles virus F protein, or they may be synthetic. The preferred signal peptide insertion site is the N-terminus down in the flow of the translation start codon and that of the transmembrane peptide is the C-terminus, such as just above the stop codon. In addition, a binding peptide can be used to connect the signal and/or transmembrane peptides to the polymerase portion.
[058] Other hydrophobic sequence(s) may be employed in the context of the present invention, such as those generally present in membrane-bound or envelope-bound proteins, including HBsAg. Of specific interest in the context of the present invention is the fusion of the polymerase portion with one or more of the immunogenic domains described herein (env1, env2, env3 and/or env4) which are hydrophobic in nature. The one or more hydrophobic domains can be fused in frame at the N-terminus, at the C-terminus or within the polymerase portion.
[059] Preferably, in the context of the present invention, the polymerase portion in use in the present invention is fused in frame to the signal and transmembrane peptides of the rabies glycoprotein. As illustrated in the example chapter below, said rabies signal sequence is fused in-frame to the N-terminus and said rabies transmembrane sequence is fused in-frame to the C-terminal of said polymerase moiety. A more preferred embodiment relates to a polymerase portion comprising, alternatively consisting essentially or alternatively consisting of an amino acid sequence which exhibits at least 80% identity, conveniently at least 85% identity, particularly at least 90% identity. identity, preferably at least 95% identity, and more preferably 100% identity with the amino acid sequence shown in SEQ ID No. 9. CENTRAL PORTION:
[060] Alternatively or in combination with the composition described above, the present invention also provides a composition comprising a central portion originating from a second HBV. As described herein with respect to HBV virus, the central portion in use in the present invention originates from an HBV that is identical or different from the HBV virus from which the polymerase portion originates. Preferably, the core and polymerase moieties both originate from an HBV of genotype D, with special preference for HBV isolate Y07587 or, alternatively, from an HBV genotype prevalent in China (such as genotype B or C).
[061] According to one embodiment, the central portion in use in the present invention may be a native HBV core (such as that shown in SEQ ID No. 2) or a core modified compared to the corresponding native HBV core which it retains by the at least one hundred amino acid residues of a core protein, with specific preference for a core portion comprising 120 to 180 amino acid residues, desirably 125 to 148 amino acid residues, and preferably 130 to 143 amino acid residues (such as about 140 amino acid residues).
[062] An appropriate modification is a truncation. Desirably, the truncation encompasses at least ten amino acid residues and at most forty amino acid residues normally present at the C-terminus of a native HBV core or within the C-terminal part (i.e., the part that encompasses the last forty). amino acid residues). This modification is particularly relevant for compositions according to the present invention which also comprise a polymerase portion, in order to reduce or exclude overlapping parts between the core and polymerase portions. It may also be relevant to the exclusion of an NLS (nuclear localization signal) in that region of the nucleus and/or to inhibit interaction with HBV polymerase. It is well within the skill of those skilled in the art to adapt the truncation to the composition according to the present invention within the indicated range of at least ten amino acid residues and at most forty amino acid residues. Appropriate truncations include 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 consecutive amino acid residues normally present at the C-terminus of a native HBV core or within its C-terminal portion. With respect to a native HBV core, the central portion used in the context of the present invention is conveniently truncated by at least twenty amino acid residues and at most forty amino acid residues, preferably by at least thirty amino acid residues and at most , 38 amino acid residues, and more preferably by at least 34 amino acid residues and at most 37 amino acid residues located at the C-terminus of a native HBV or within the C-terminal part with special preference for a truncation that includes the last 35 amino acid residues of a native HBV core (in other words, the truncation extends from approximately position 149 to the C-terminus of the core polypeptide).
Of specific interest is a central portion comprising an amino acid sequence that exhibits at least 80% identity, conveniently at least 85% identity, preferably at least 90% identity, more preferably at least 95% identity and more preferably still 100% identity with the portion of the amino acid sequence shown in SEQ ID No. 2 which extends from position 1 to approximately position 148, and preferably even greater, a central portion comprising a sequence of amino acid which exhibits at least 80% identity, conveniently at least 85% identity, preferably at least 90% identity, more preferably at least 95% identity, and most preferably 100% identity with the sequence of amino acids shown in SEQ ID NO. 10.
[064] Alternatively or in combination, the central portion is modified so as to exhibit reduced recognition and/or interaction with an HBV envelope protein relative to a native HBV core. Conveniently, the aforementioned reduction in recognition and interaction is provided by one or more mutations in an inner-site region in the vicinity of residue 80 which is predicted to form an exposed outer circuit on the surface of core particles (Argos et al, 1988, EMBO J . 7: 819). Reduction or ablation of recognition or interaction with an env protein can be performed using tests well known in the art (such as electron microscopy, analysis of nucleocapsid formation in cells, virions secreted after transient transfection in HuH7, as described in Seitz et al. , 2007, EMBO J., 26: 416 or in Ponsel et al, 2003, J. Virol. 77 (1): 416).
[065] A preferred modification comprises the deletion of one or more amino acid residues in the central region extending from approximately position 75 to approximately position 85 (corresponding to residues 75 to 85 of SEQ ID No. 2 and SEQ ID No. 10 ), with special preference for excluding the central portion extending from approximately position 77 to approximately position 84 (corresponding to residues 77-84 of SEQ ID No. 2 and SEQ ID No. 10). A preferred central portion comprises, alternatively consists essentially or alternatively consists of an amino acid sequence which exhibits at least 80% identity, conveniently at least 85% identity, preferably at least 90% identity, more preferably at least 95% identity. identity, and preferably still greater, 100% identity to the amino acid sequence shown in SEQ ID No. 11 or to the amino acid sequence shown in SEQ ID No. 2 which lacks residues 77 to 84. ENV PORTION:
[066] Alternatively or in combination with the composition described above, the present invention also provides a composition comprising an env portion. Said env portion comprises one or more immunogenic domains of at least fifteen consecutive amino acid residues present in an HBs protein originating from a third HBV virus. Preferably, each of said immunogenic domains corresponds to a portion of at least twenty amino acids and at most one hundred amino acids present in an HBsAg protein, whether native or modified (such as modified in a way that is representative of a specific genotype). Each of the immunogenic domains may originate from identical or different HBV virus(es) which may be identical or different with respect to the HBV virus from which it(es) give rise to the core and polymerase portions. Preferably, each of the immunogenic env domains originates from an HBV genotype D and especially from HBV isolate Y07587 or, alternatively, from an HBV genotype prevalent in China (such as genotype B or C).
[067] Conveniently, each of the one or more immunogenic domains comprises specific T cell epitopes for helper T cells (TH) and/or for cytotoxic T cells (CTL) that may be restricted to various class I and MHC antigens /or class II (such as A2, A24, DR, DP etc.). Such epitopes have been described in the art ( WO 93/03764; WO 94/19011; Desombere et al, 2000, Clin. Exp. Immunol. 122: 390; Loirat et al, 2000, J. Immunol. 165: 4748; Schirmbeck et al. , 2002, J. Immunol. 168-6253; Depla et al, 2008, J. Virol. 82: 435) and the design of the appropriate immunogenic domain(s) is within the scope of those skilled in the art. ) as described herein within the indicated range of fifteen to one hundred amino acid residues which includes (in) B, TH and/or CTL epitopes of a native env protein (such as shown in SEQ ID NO: 3). Preferably, the env portion comprised or encoded by the composition according to the present invention does not include any immunogenic domain originating from preS1 and preS2 regions.
[068] The present invention encompasses an env portion that comprises an immunogenic domain and also those that comprise two, three or more.
[069] Desirably, the one or more immunogenic domains in use in the present invention is(are) selected from the group consisting of: - the part of an env protein (HBsAg) that extends from position 14 to 51 (env 1 domain); - the part of an env protein (HBsAg) extending from position 165 to 194 (env domain 2); - the part of an env protein (HBsAg) extending from position 81 to 106 (env domain 3); - the part of an env protein (HBsAg) extending from position 202 to 226 (env domain 4); and - any of their combinations.
[070] Immunogenic domain(s) particularly suitable for use in the present invention comprise(s) alternatively consist(s) essentially or alternatively consist(es) of an amino acid sequence exhibiting at least 80% of identity, conveniently at least 85% identity, preferably at least 90% identity, more preferably at least 95% identity, and most preferably 100% identity to any of the amino acid sequences shown in SEQ ID NO. ° 12 to 15.
[071] In the context of the present invention, the combination of immunogenic domains may take the form of a mixture of individual immunogenic domains in the composition according to the present invention or as an in-frame fusion between two or more immunogenic domains in any possible arrangement (such as merging or mixing env1-env2, env2-env1, env1-env3, env3-env1, env1-env4, env4-env1, env2-env3, env3-env2, env2-env4, env4-env2, env3-env4, env4-env3, env1-env2-env3, env2-env1-env3, env1-env2-env4 etc.). Furthermore, combinations can comprise one or more of their copies (such as env1-env2-env1, env1-env4-env1 etc.). Fusion between each immunogenic domain can be direct or via a linker.
[072] The env portions of specific interest in the context of the present invention comprise the fusion of two or three immunogenic domains shown in SEQ ID No. 12-15, with special preference for an env1-env2 fusion comprising, alternatively consists essentially or alternatively consists of an amino acid sequence which exhibits at least 80% identity, conveniently at least 85% identity, preferably at least 90% identity, more preferably at least 95% identity, and most preferably at least 100% identity. identity to the amino acid sequence shown in SEQ ID No. 16 or an env1-env2-env4 fusion comprising, alternatively consists essentially or alternatively consists of an amino acid sequence that exhibits at least 80% identity, conveniently at least 85% of identity, preferably at least 90% identity, more preferably at least 95% identity and most preferably at least 100% identity with the amino acid sequence shown in SEQ ID NO:17.
[073] According to a specific embodiment, the polymerase, central and/or env portions comprised or encoded by the composition according to the present invention can be fused in frame by pairs or all together. One can idealize, for example, the fusion of the env polymerase moieties into a single polypeptide chain. Alternatively, the central and env portions can be fused in-frame into a single polypeptide chain. Again at this point, the encoding nucleic acid sequences can be fused directly or via a linker. Conveniently, the env portion is fused in-frame to the C-terminus of the central or polymerase portion.
[074] Preferred examples of fusion polypeptides of the central portion with the env portion are selected from the group consisting of: - a polypeptide comprising alternatively consisting essentially or alternatively consisting of an amino acid sequence exhibiting at least 80% of identity, conveniently at least 85% identity, preferably at least 90% identity, more preferably at least 95% identity, and most preferably 100% identity with the amino acid sequence shown in SEQ ID NO:18 (core*t-env1); - a polypeptide comprising, alternatively consisting essentially or alternatively consisting of an amino acid sequence exhibiting at least 80% identity, conveniently at least 85% identity, preferably at least 90% identity, more preferably at least 95% identity identity or, preferably still greater, 100% identity with the amino acid sequence shown in SEQ ID NO:19 (core*t-env1-env2); and - a polypeptide comprising, alternatively consisting essentially or alternatively consisting of an amino acid sequence exhibiting at least 80% identity, conveniently at least 85% identity, preferably at least 90% identity, more preferably at least 95% of identity or, preferably still more, 100% identity with the amino acid sequence shown in SEQ ID N° 20 (core-env1-env2-env4) or with the part of the amino acid sequence shown in SEQ ID N° 20 to from residue 1 to residue 251 (core-env1-env2) or with the portion of the amino acid sequence shown in SEQ ID No. 20 from residue 1 to residue 221 (core-env1); or its deleted versions that do not contain residues 77 to 84 in the central portion.
[075] In the context of the present invention, the polymerase portion, the central portion and/or the env portion comprised or encoded by the composition according to the present invention may further comprise further modifications. Appropriate modifications are those that are beneficial to the synthesis, processing, stability and solubility of the resulting polypeptide (such as those intended to modify potential cleavage sites, potential glycosylation sites and/or membrane anchoring as described herein) as well. as those that are beneficial to the immunogenicity of the resulting composition (such as incorporation or fusion with one or more compounds capable of enhancing the immunogenic properties). These compounds capable of enhancing immunogenic properties have been described in the literature and include, without limitation, calreticulin (Cheng et al, 2001, J. Clin. Invest. 108: 669), Mycobacterium tuberculosis 70 hot shock protein (HSP70) (Chen et al, 2001, al, 2000, Cancer Res. 60: 1035), ubiquitin (Rodriguez et al, 1997, J. Virol. 71: 8497), bacterial toxin such as the translocation domain of Pseudomonas aeruginosa exotoxin A (ETA(dIII) (Hung et al, 2001, Cancer Res. 61:3698), as well as T helper epitope(s) such as Pan-Dr peptide (Sidney et al, 1994, Immunity 1:751), pstS1 GCG epitope (Vordermeier et al. , 1992, Eur. J. Immunol. 22: 2631), tetanus toxoid peptides P2TT (Panina-Bordignon et al, 1989, Eur. J. Immunol. 19: 2237) and P30TT (Demotz et al, 1993, Eur. J. Immunol. 23:425), influenza epitope (Lamb et al, 1982, Nature 300:66) and hemagglutinin epitope (Rothbard et al, 1989, Int. Immunol. 1:479). NUCLEIC ACID MOLECULE:
[076] The present invention also provides isolated nucleic acid molecules that encode, independently or in combination, the polymerase, core and env portions in use in the present invention, as well as compositions comprising such acid molecule(s) nucleic acid.
[077] Of specific interest are: - nucleic acid molecules encoding polymerase moieties as described herein, with special preference for those comprising the amino acid sequence shown in any one of SEQ ID N° 7, 8, 9 or a amino acid sequence shown in SEQ ID No. 7 with the replacement of the Asp residue at position 494 by a His residue and the replacement of the Glu residue at position 672 by a His residue; - nucleic acid molecules encoding core portions described herein, with special preference for those comprising the amino acid sequence shown in SEQ ID NO: 10 or 11; - Nucleic acid molecules encoding the env portions described herein, with special preference for those comprising the amino acid sequence shown in any one of SEQ ID Nos. 12 to 17; and - nucleic acid molecules encoding the central and fused env portions described herein, with special preference for those comprising the amino acid sequences shown in any one of SEQ ID No. 18, 19 or 20 or the portion of the amino acid sequence shown in SEQ ID No. 20 from residue 1 to residue 251 (core-env1-env2) or the portion of the amino acid sequence shown in SEQ ID No. 20 from residue 1 to residue 221 (core-env1); or its deleted versions that lack central residues 77 to 84 of SEQ ID NO. 20.
Desirably, the nucleic acid molecules according to the present invention can be optimized to provide high level expression in a specific host organism or cell, such as mammalian, yeast (such as Saccharomyces cerevisiae, Saccharomyces pombe or Pichia pastoris ) or bacteria (such as E. coli, Bacillus subtilis or Listeria). In fact, it has been observed that when more than one codon is available to encode a given amino acid, the codon usage patterns of organisms are highly non-random (see, for example, Wada et al, 1992, Nucleic Acids Res. 20 : 2111) and codon usage can be markedly different between different hosts (see, for example, Nakamura et al, 1996, Nucleic Acids Res. 24: 214). As most of the nucleotide sequences used in the present invention are of viral origin (HBV), they may have an inadequate codon usage pattern for efficient expression in host cells such as bacterial lower or higher eukaryotic cells. Typically, codon optimization is performed by replacing one or more "native" codons (such as HBV) corresponding to a rarely used codon in the host cell of interest with one or more codons that encode the same amino acid that is more frequently used. It is not necessary to replace all native codons corresponding to rarely used codons, as it is possible to achieve greater expression even with partial replacement. In addition, some deviations from strict adherence to optimized codon usage can be made to accommodate the introduction of restriction site(s) into the resulting nucleic acid molecule.
[079] Furthermore, to optimize the use of codons, expression in the host organism or cell can be further enhanced through additional modifications of the nucleotide sequence. The nucleic acid molecule according to the present invention can be modified, for example, in order to avoid the formation of rare non-ideal codon sets that are present in concentrated areas and/or to suppress or at least partially modify sequence elements that are expected to negatively influence expression levels. These negative sequence elements include, without limitation, regions that have very high (>80%) or very low (<30%) GC content; stretches of AT-rich or GC-rich sequences; unstable direct or inverted repeat sequences; RNA secondary structures; and/or internal cryptic regulatory elements such as internal TATA boxes; chi sites, ribosome entry sites and/or dividing donor/recipient sites. Another embodiment of the present invention relates to fragments of the nucleic acid molecule according to the present invention, such as fragments generated by PCR and restriction endonuclease. These fragments can be used as probes, primers or fragments that encode an immunogenic portion of the first and/or second polypeptide.
[080] A preferred nucleic acid molecule according to the present invention is selected from the group consisting of: - a nucleic acid molecule comprising a nucleotide sequence that exhibits at least 80% identity with the nucleotide sequence shown in SEQ ID No. 21 (encoding the truncated Pol of SEQ ID No. 7); - a nucleic acid molecule comprising a nucleotide sequence which exhibits at least 80% identity with the nucleotide sequence shown in SEQ ID No. 22 (which encodes the mutated pol of SEQ ID No. 8); - a nucleic acid molecule comprising a nucleotide sequence that exhibits at least 80% identity with the nucleotide sequence shown in SEQ ID NO: 21 with the replacement of nucleotide G at position 1480 by a C, nucleotide G at position 2014 by a C and of the nucleotide A at position 2016 by a T (which encodes the Pol that underwent mutation of SEQ ID N° 7 with the substitution of mutations D540H and E718H); - a nucleic acid molecule comprising at least 80% identity with the nucleotide sequence shown in SEQ ID No. 23 (encoding the truncated Pol-TMR mutated from SEQ ID No. 9); - a nucleic acid molecule comprising a nucleotide sequence which exhibits at least 80% identity with the nucleotide sequence shown in SEQ ID No. 24 (encoding nucleus*t-env1 of SEQ ID No. 18); - a nucleic acid molecule comprising a nucleotide sequence which exhibits at least 80% identity with the nucleotide sequence shown in SEQ ID No. 25 (encoding nucleus*t-env1-env2 of SEQ ID No. 19); and - a nucleic acid molecule comprising a nucleotide sequence that exhibits at least 80% identity with the nucleotide sequence shown in SEQ ID No. 26 (encoding nucleus-env1-env2-env4 of SEQ ID No. 20) or with the part of the nucleotide sequence shown in SEQ ID No. 26 from nucleotide 1 to nucleotide 753 (which encodes nucleus-env1-env2) or with the part of the nucleotide sequence shown in SEQ ID No. 26 from nucleotide 1 to nucleotide 663 (which encodes nucleus-env1); or its deleted versions which do not contain the part extending from the G at position 229 to the A at position 252 of SEQ ID NO: 26 (corresponding to the deletion of residues 77 to 84 in the central portion).
[081] Nucleic acid molecules according to the present invention can be generated using art-accessible sequence data and the sequence information provided herein. The DNA sequence encoding each of the HBV polypeptides can be isolated directly from cells containing HBV, cDNA and genomic libraries, viral genomes or any prior art vector known to include it, by means of PCR or molecular biology methods conventional and can be modified (as described herein). Alternatively, the nucleic acid molecule according to the present invention can also be generated by means of chemical synthesis in an automated process (assembled, for example, from overlapping synthetic oligonucleotides as described, for example, in Edge, 1981, Nature 292, 756; Nambair et al, 1984, Science 223: 1299; Jay et al, 1984, J. Biol. Chem. 259: 6311).
[082] Also provided by the present invention are vectors comprising one or more nucleic acid molecules according to the present invention, as well as compositions comprising such vector(s).
[083] Several host and vector systems can be used in the context of the present invention, including bacteriophages, plasmid or cosmid vectors adapted for expression in prokaryotic host organisms, such as bacteria (such as E. coli, Bacillus subtilis or Listeria); vectors adapted for expression in yeast (such as Saccharomyces cerevisiae, Saccharomyces pombe and Pichia pastoris); viral expression vectors (such as bacilloviruses) adapted for expression in insect cell systems (such as Sf9 cells); plasmid or virus expression vectors (such as Ti plasmid, cauliflower mosaic virus CaMV; tobacco mosaic virus TMV) adapted for expression in plant cell systems; as well as viral vectors and plasmids adapted for expression in higher eukaryotic organisms or cells. Such vectors are largely described in the literature and commercially available (such as in Stratagene, Amersham Biosciences, Promega etc.). Representative examples of suitable plasmid vectors include, without limitation, pREP4, pCEP4 (Invitrogene), pCI (Promega), pCDM8 (Seed, 1987, Nature 329, 840) and pMT2PC (Kaufman et al, 1987, EMBO J. 6: 187 ), pVAX and pgWiz (Gene Therapy System Inc.; Himoudi et al, 2002, J. Virol. 76: 12735). Various viral vectors can also be used in the context of the present invention, derived from a number of different viruses (such as retroviruses, adenoviruses, AAV, poxviruses, herpes virus, measles virus, foamy virus, alphavirus, vesicular stomatitis virus and the like ).
[084] Of specific interest are adenoviral vectors that have a number of well-documented advantages for gene transfer or recombinant production (for analysis, see Adenoviral Vectors for Gene Therapy, 2002, Ed. D. Curiel and J. Douglas, Academic Press) . Adenoviral vectors for use in accordance with the present invention can be derived from a variety of human or animal sources (such as canine, ovine, simian adenoviruses etc.). Any serotype can be used with specific reference to human adenoviruses and specific preference for subgenus C such as Ad2 (Ad2), 5 (Ad5), 6 (Ad6), subgenus B such as 11 (Ad11), 34 (Ad34) and 35 (Ad35) and subgenus D such as 19 (Ad19), 24 (Ad24), 48 (Ad48) and 49 (Ad49). It may also be convenient to use animal Ad with specific preference for chimpanzee Ad, such as chimpanzee Ad3 (Peruzzi et al, 2009, Vaccine 27: 1293) and chimpanzee Ad63 (Dudareva et al, 2009, Vaccine 27: 3501). The adenoviruses mentioned are available through the North American Type Cultivation Collection (ATCC, Rockville MD) or have been the subject of numerous publications describing their sequence, organization and production methods, allowing their application by technicians in the field ( see, for example, US 6,133,028; US 6,110,735; WO 02/40665; WO 00/50573; EP 1016711; Vogels et al, 2003, J. Virol. 77: 8263; WO 00/70071; WO 02/ 40665; WO 2004/001032; WO 2004/083418; WO 2004/097016; WO 2005/010149).
[085] In one embodiment, the adenoviral vector according to the present invention has a replication defect. Preferred replication-defective adenoviral vectors are E1 defective (see, for example, US 6,136,594 and US 6,013,638), with an E1 deletion extending from approximately positions 459 to 3328 or approximately from positions 459 to 3510 (by reference to the sequence of human adenovirus type 5 described in GeneBank accession number M 73260 and in Chroboczek et al, 1992, Virol. 186:280). The cloning capability can be further enhanced by excluding additional part(s) of the adenoviral genome (the non-essential E3 region or other essential E2, E4 regions, in whole or in part, as described in WO 94/ 28152; Lusky et al, 1998, J. Virol. 72: 2022).
[086] The nucleic acid molecule(s) according to the present invention can be inserted at any site of the adenoviral genome, with specific preference for insertion in place of the E1 region. It(s) can be positioned in meaningless or nonsensical orientation with respect to the natural transcription direction of the region in question.
[087] Other viral vectors suitable in the context of the present invention are derived from poxviruses (see, for example, Cox et al in Viruses in Human Gene Therapy, Ed. J.M. Hos, Carolina Academic Press). In the context of the present invention, a poxvirus vector can be obtained from any member of the pox virids, particularly canarypox, birdpox and vaccinia virus, where the latter is preferred. Suitable vaccinia viruses include, without limitation, the Copenhagen lineage (Goebel et al, 1990, Virol. 179:247 and 517; Johnson et al, 1993, Virol. 196:381), the Wyeth lineage, and the modified Ankara lineage (MVA) (Antoine et al, 1998, Virol. 244:365). General conditions for construction of recombinant poxviruses are well known in the art (see, for example, EP 206920; Mayr et al, 1975, Infection 3:6; Sutter and Moss, 1992, Proc. Natl. Acad. Sci. USA 89: 10847; US 6,440,422). The nucleic acid molecule according to the present invention is preferably inserted into the poxvirus genome at a non-essential site. The thymidino kinase gene is particularly suitable for insertion into Copenhagen vaccine vectors (Hruby et al, 1983, Proc. Natl. Acad. Sci. USA 80:3411; Weir et al, 1983, J. Virol. 46:530) and deletion II or III for insertion into MVA vector (Meyer et al, 1991, J. Gen. Virol. 72: 1031; Sutter et al, 1994, Vaccine 12: 1032).
[088] The present invention also encompasses vectors (such as plasmid DNA) in complex with lipids or polymers to form particulate structures such as liposomes, lipoplexes or nanoparticles. Such technologies are available in the art (see, for example, Arangoa et al, 2003, Gene Ther. 10: 5; Eliaz et al, 2002, Gene Ther. 9: 1230 and Betageri et al, 1993, Liposome Drug Delivery Systems, Technomic Publishing Company, Inc.).
[089] According to a preferred embodiment, the vectors according to the present invention comprise the nucleic acid molecule(s) according to the present invention in a form suitable for expression in a host organism or cell, which means that the nucleic acid molecule(s) is(are) placed under the control of one or more regulatory sequences, appropriate for the vector and/or the host cell. Those skilled in the art will appreciate that the choice of regulatory sequences may depend on factors such as the host cell, the desired expression level etc.
[090] The promoter is of special importance and suitable promoters useful in the context of the present invention include constitutive promoters that direct the expression of the nucleic acid molecule(s) in many types of host cells and those that direct the expression of ( s) nucleic acid molecule(s) only in certain host cells (such as liver-specific regulatory sequences) or in response to exogenous factors or specific events (such as through temperature, nutrient additives, hormones or other ligands).
[091] Suitable promoters for constitutive expression in mammalian cells include, but are not limited to, the cytomegalovirus (CMV) intermediate early promoter (Boshart et al, 1985, Cell 41:521), the RSV promoter, the higher end promoter from adenovirus, the phosphoglycerokinase (PGK) promoter (Adra et al, 1987, Gene 60: 65) and the thymidino kinase (TK) promoter from herpes simplex virus (HSV)-1. Vaccinia virus promoters are particularly adapted for expression in poxvirus vectors. Representative examples include, without limitation, the vaccinia promoter 7.5K, H5R, 11K7.5 (Erbs et al, 2008, Cancer Gene Ther. 15:18), TK, p28, p11 and K1L, as well as synthetic promoters such as described in Chakrabarti et al (1997, Biotechniques 23:1094, in connection with the pSE/L promoter), Hammond et al (1997, J. Virological Methods 66:135) and Kumar and Boyle (1990, Virology 179:151), as well as early/late chimeric promoters. Liver-specific promoters include, without limitation, those of HMG-CoA reductase (Luskey, 1987, Mol. Cell Biol. 7: 1881); sterol regulatory element 1 (SRE-1; Smith et al, 1990, J. Biol. Chem. 265:2306); albumin (Pinkert et al, 1987, Genes Dev. 1:268); phosphoenol pyruvate carboxy kinase (PEPCK) (Eisenberger et al, 1992, Mol. Cell Biol. 12: 1396); human C-reactive protein (CRP) (Li et al, 1990, J. Biol. Chem. 265:4136); human glucokinase (Tanizawa et al, 1992, Mol. Endocrinology 6:1070); Cholesterol 7-alpha hydroylase (CYP-7) (Lee et al, 1994, J. Biol. Chem. 269:14681); alpha-1 antitrypsin (Ciliberto et al, 1985, Cell 41: 531); insulin-like growth factor binding protein (IGFBP-1) (Babajko et al, 1993, Biochem. Biophys. Res. Comm. 196:480); human transferrin (Mendelzon et al, 1990, Nucleic Acids Res. 18: 5717); type I collagen (Houglum et al, 1994, J. Clin Invest. 94: 808) and FIX genes (US 5,814,716).
[092] Those skilled in the art will appreciate that the regulatory elements that control the expression of the nucleic acid molecule(s) according to the present invention may further comprise additional elements for proper initiation, regulation and/or termination of transcription ( such as polyA transcription termination sequences), mRNA transport (such as nuclear localization signal sequences), processing (such as division signals) and stability (such as introns and 3' and 5' non-coding sequences), translation (such as a Met initiator, tripartite leader sequences, ribosome binding sites, Shine-Dalgarno sequences etc.) in the host organism or cell and purification steps (such as a tag).
[093] According to the present invention, the nucleic acid molecules according to the present invention that encode said polymerase portion, said central portion and/or said env portion may be driven by the same vector or at least two vectors ( such as two or three independent vectors). Thus, the present invention encompasses a vector that carries the nucleic acid molecules encoding said polymerase portion, said core portion and said env portion as well as independent vectors, each of which carries only one or two of the molecules of nucleic acid encoding said polymerase portion, said core portion and said env portion. Such vector(s) is also provided by the present invention, as well as compositions comprising such vector(s). When using different vectors, they can be from different origins or from the same origin. One can idealize, for example, the expression of an HBV portion of a defective poxvirus (such as MVA) and the expression of the other two portions from another poxvirus vector (such as a vector from Copenhagen). As another example, one can devise a composition comprising an adenoviral vector encoding the polymerase portion and an adenoviral vector encoding the central and env portions. Alternatively, expression from different viral vectors (such as expression of the polymerase portion from an adenoviral vector and expression of central and/or env portions of MVA or vice versa) is also appropriate in the context of the present invention as well. as the expression of the HBV portions of plasmid vector(s) and viral(s).
[094] Preferred embodiments of the present invention relate to vectors selected from the group consisting of: (i) An MVA vector comprising a nucleic acid molecule placed under the control of a vaccinia promoter such as the 7.5K promoter and which encodes a polymerase portion comprising an amino acid sequence as shown in SEQ ID No. 7, 8 or 9 or in SEQ ID No. 7 with the replacement of the Asp residue at position 494 by a His residue and the replacement of the residue Glu at position 672 by a His residue. Preferably, said nucleic acid molecule is inserted into exclusion III of the MVA genome. (ii) An MVA vector which comprises a nucleic acid molecule placed under the control of a vaccinia promoter such as the pH5r promoter and which encodes a central portion and an env portion which comprises an amino acid sequence as shown in SEQ ID NO. 18 or 19. Preferably, said nucleic acid molecule is inserted into exclusion III of the MVA genome. (iii) An E1 defective Ad vector comprising, inserted in place of the E1 region, a nucleic acid molecule placed under the control of the CMV promoter and encoding a polymerase portion comprising an amino acid sequence as shown in SEQ ID No. 7, 8 or 9 or in SEQ ID No. 7 with the replacement of the Asp residue at position 494 by a His residue and the replacement of the Glu residue at position 672 by a His residue. (iv) An E1 defective Ad vector comprising, inserted in place of the E1 region, a nucleic acid molecule placed under the control of the CMV promoter and encoding a central portion and an env portion comprising an amino acid sequence as shown. in SEQ ID No. 18, 19 or 20 or the portion of SEQ ID No. 20 from residue 1 to residue 251 (core-env1-env2) or the portion of SEQ ID No. 20 from residue 1 to residue 221 ( core-env1).
[095] As well as a composition comprising vectors (i) and (ii) or (iii) and (iv).
[096] If necessary, the vector or composition according to the present invention may further comprise one or more transgenes, such as a gene of interest to be expressed together with the nucleic acid molecule(s) according to with the present invention in a host organism or cell. Desirably, the expression of the transgene has therapeutic or protective activity towards an HBV infection or any disease or condition caused or associated with an HBV infection or is capable of increasing the immunogenicity of the composition according to the present invention. Appropriate transgenes include, without limitation, one or more additional HBV polypeptide(s)/peptide(s) or encoding nucleic acid molecule(s) such as protein X or fragment thereof, immunomodulators such as cytokine (e.g. IL-2, IL-7, IL-12, IL-15, IL-18, IL-21, IFNg), cytokine fusion (such as those described in WO 2005/14642) or molecules thereof of nucleic acid encoding as well as suicide gene products or encoding nucleic acid molecules particularly useful in the context of treating liver carcinoma (such as cytosine deaminase (CDase), uracil phosphoribosyl transferase (URPTase), the FCU-1 gene product (described in WO 99/54481) and its derivatives (described in WO 2006/048768), which are to be used with the prodrug 5-fluorocytosine (5-FC) If a transgene is used, it can be expressed as a fusion with any of the nucleic acid molecules according to the present invention or be expressed independently under the control of appropriate regulatory elements. Furthermore, it can be inserted anywhere in the vector according to the present invention or in an independent vector that is used in combination with the vector(s) or composition according to the present invention.
[097] In another aspect, the present invention provides infectious viral particles comprising the nucleic acid molecules or vectors according to the present invention, as well as compositions comprising these infectious viral particles.
[098] Typically, these viral particles are produced through a process that comprises the steps of: a. introduction of the viral vector according to the present invention into an appropriate cell line; B. culturing said cell line under appropriate conditions so as to allow for the production of said infectious viral particle; ç. recovery of the infectious viral particle produced from the cultivation of said cell line; and d. optional purification of said recovered infectious viral particle.
[099] When the viral vector is defective, the infectious particles are usually produced in a complementing cell line or using a helper virus, which supplies non-functional viral genes in trans. Cell lines suitable for complementing E1-depleted adenoviral vectors include, for example, 293 cells (Graham et al, 1997, J. Gen. Virol. 36, 59-72), as well as HER-96 and PER- cells. C6 (such as Fallaux et al, 1998, Human Gene Ther. 9, 1909-1917; WO 97/00326). Suitable cells for propagating poxvirus vectors are avian cells and, more preferably, primary chicken embryo fibroblasts (CEF) prepared with chicken embryos obtained from fertilized eggs.
[0100] Infectious viral particles can be recovered from the culture supernatant or cells after lysis. They can be further purified according to standard methods (chromatography, cesium chloride gradient ultracentrifugation as described, for example, in WO 96/27677, WO 98/00524, WO 98/22588, WO 98/26048, WO 00/ 40702, EP 1016700 and WO 00/50573).
[0101] The present invention also encompasses viral vectors or particles that have been modified to allow preferential targeting to a specific target cell (see, for example, Wickam et al, 1997, J. Virol. 71, 8221-8229; Arnberg et al., 1997, J. Virol. 71, 8221-8229; al, 1997, Virol. 227, 239-244; Michael et al, 1995, Gene Therapy 2, 660-668; WO 94/10323; WO 02/96939 and EP 1,146,125 ). A characteristic function of targeted vectors and viral particles according to the present invention is the presence on their surface of a ligand capable of recognizing a cell component and exposed on the surface and binding to it, such as a cell-specific marker (such as an HBV-infected cell), a tissue-specific marker (such as a liver-specific marker), as well as a viral antigen (such as HBV). Examples of suitable linkers include antibodies or fragments thereof directed to an HBV antigenic domain. Cell targeting can be conducted through the genetic insertion of the ligand into a polypeptide present on the surface of the virus (such as adenoviral fiber, penton, pIX or vaccinia p14 gene product).
[0102] The present invention also relates to host cells comprising the infectious nucleic acid molecules, vectors or viral particles according to the present invention, as well as compositions comprising such host cells. In the context of the present invention, host cells include prokaryotic cells, lower eukaryotic cells such as yeast and other eukaryotic cells such as insect cells, plant and mammalian cells (such as humans or non-humans), as well as capable complementary cells of complementing at least one defective function of a replication defective vector according to the present invention (such as adenoviral vector), such as 293 and PERC.6 cells.
[0103] According to a specific embodiment of the present invention, the host cell can be additionally encapsulated. Cell encapsulation technology has previously been described (Tresco et al, 1992, ASAIO J. 38, 17-23; Aebischer et al, 1996, Human Gene Ther. 7, 851-860).
[0104] Yet another aspect of the present invention is a method of producing recombinant polymerase, core and/or env moieties, employing the vectors, infectious viral particles and/or host cells according to the present invention. The method according to the present invention comprises (a) introducing a vector or an infectious viral particle according to the present invention into an appropriate host cell to produce an infected or transfected host cell; (b) in vitro cultivation of said infected or transfected host cell under appropriate conditions for growth of the host cell; (c) recovery of the polymerase, core and/or env portion(s) from the cell culture; and (d) optional purification of the recovered polypeptide(s).
[0105] It is expected that the technicians in the subject know the various expression systems available for production of the portion(s) of HBV in appropriate host cells and the methods of introducing vectors or infectious viral particles into a host cell. Such methods include, but are not limited to, microinjection (Capechi et al, 1980, Cell 22: 479), CaPO4 mediated transfection (Chen and Okayama, 1987, Mol. Cell Biol. 7: 2745), DEAE-dextran mediated transfection, electroporation (Chu et al, 1987, Nucleic Acid Res. 15: 1311), lipofection/liposome fusion (Felgner et al, 1987, Proc. Natl. Acad. Sci. USA 84: 7413), particle bombardment (Yang et al. , 1990, Proc. Natl. Acad. Sci. USA 87: 9568), gene triggers, transduction, viral infections and direct administration into a host organism by various means.
[0106] The vectors according to the present invention can be used in association with transfection reagents in order to facilitate the introduction of the vector into the host cell, such as polycationic polymers (such as chitosan, polymethacrylate, PEI etc.) and cationic lipids ( such as DC-Chol/DOPE, transfect lipofectin now available through Promega). In addition, as discussed above, recombinant DNA technologies can be used to increase the expression of the nucleic acid molecule(s) in the host organism or cell, using, for example, high copy number vectors, replacing or modifying one or more transcriptional regulatory sequences (such as promoter, enhancer or the like), optimization of codon usage of the nucleic acid molecule(s) for the host cell, and suppression of negative sequences that might destabilize the transcript.
[0107] The host cells according to the present invention can be cultured in conventional fermentation bioreactors, Petri dishes and flasks. Cultivation can be carried out at the temperature, pH and oxygen content appropriate for a given host cell. No attempt will be made at present to describe in detail the various known methods of protein production in eukaryotic and prokaryotic cells.
[0108] The portion(s) of HBV can be further purified by well-known purification methods, which include ammonium sulfate precipitation, acid extraction, gel electrophoresis; filtration and chromatographic methods (such as reverse phase chromatography, size exclusion, ion exchange, affinity, phosphocellulose, hydrophobic interaction, hydroxylapatite or high performance liquids). The conditions and technology to be used depend on factors such as net charge, molecular weight, hydrophobicity, hydrophilicity and will be apparent to those skilled in the art. Furthermore, the level of purification will depend on the intended use.
[0109] In another aspect, the present invention provides a composition comprising at least one of the polymerase, core and/or env portions, the encoding nucleic acid molecules, the vector(s), the ) infectious viral particle(s) or the host cell according to the present invention (also referred to herein as "active agent") or any combination thereof (such as a combination of polypeptides or vectors/viral particles that encode various portions of HBV as described herein or a combination of different genotypes). Preferably, the composition is a pharmaceutical composition which comprises a pharmaceutically acceptable carrier up to a therapeutically effective amount of the active agent(s).
[0110] Suitably, the composition according to the present invention comprises a diluent suitable for human or animal use. It is preferably isotonic, hypotonic or weakly hypertonic and has relatively low ionic strength. Representative examples include sterile water, physiological saline solution (such as sodium chloride), Ringer's solution, glucose, trehalose or sucrose solutions, Hank's solution and other aqueous physiologically balanced saline solutions (see, for example, the most recent edition of Remington: The Science and Practice of Pharmacy, A. Gennaro, Lippincott, Williams & Wilkins). The composition according to the present invention is suitably buffered so that it is suitable for human use under physiological or slightly basic pH (such as from about pH 7 to about pH 9). Suitable buffers include, without limitation, phosphate buffer (such as PBS), bicarbonate buffer and/or Tris buffer.
[0111] The composition may also contain other pharmaceutically acceptable excipients to provide desirable pharmaceutical or pharmacodynamic properties, including, for example, modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution of the formulation, modification or maintenance of release or absorption in the human or animal organism, promotion of transport across the blood barrier or penetration into a specific organ (such as the liver). Suitable excipients include amino acids.
[0112] The pharmaceutically acceptable carriers included in the composition according to the present invention should also allow for the preservation of their stability under the conditions of manufacture and long-term storage (i.e., at least one month) in freezing (such as -70 °C, -20 °C) refrigerated (such as 4 °C) or ambient temperatures. In this aspect, formulations which are particularly adapted to the composition according to the present invention include: - 1 M sucrose, 150 mM NaCl, 1 mM MgCl 2 , 54 mg/l Tween 80, 10 mM Tris, pH 8 .5 (especially when the active agent is an adenoviral vector); - 10 mg/ml mannitol, 1 mg/ml HSA, 20 mM Tris, pH 7.2 and 150 mM NaCl; and - physiological saline solution.
[0113] In addition, the composition according to the present invention may comprise one or more adjuvants suitable for systemic or mucosal application in humans. Preferably, the adjuvant is capable of stimulating immunity to the composition according to the present invention, especially T cell mediated immunity, such as via toll-like receptors (TLR) such as TLR-7, TLR-8 and TLR -9. Representative examples of useful adjuvants include, without limitation, alum, mineral oil emulsion such as Freunds complete or incomplete (IFA), lipopolysaccharide or one of its derivatives (Ribi et al, 1986, Immunology and Immunopharmacology of Bacterial Endotoxins, Plenum Publ. Corp. Corp.). ., New York, pp. 407-419), saponins such as QS21 (Sumino et al, 1998, J. Virol. 72:4931; WO 98/56415); imidazoquinoline compounds such as Imiquimod ( Suader, 2000, J. Am. Acad. Dermatol. 43: S6), S-27609 (Smorlesi, 2005, Gene Ther. 12: 1324 ) and related compounds such as those described in WO 2007/ 147529, guanosine cytosine phosphate oligodeoxynucleotides such as CpG (Chu et al, 1997, J. Exp. Med. 186: 1623; Tritel et al, 2003, J. Immunol. 171: 2358) and cationic peptides such as IC-31 ( Kritsch et al, 2005, J. Chromatogr. Anal. Technol. Biomed. Life Sci. 822:263).
[0114] The composition according to the present invention is suitable for a number of modes of administration, including systemic, topical and localized administration. Injection can be performed by any means, such as by subcutaneous, intradermal, intramuscular, intravenous, intraperitoneal, intratumoral, intravascular, intraarterial injection or by direct injection into an artery (such as by means of hepatic artery infusion) or into a liver-supplying vein (such as a portal vein injection). Injections can be performed with conventional syringes and needles or any other suitable devices available in the art. Alternatively, the composition according to the present invention may be administered via the mucosa, such as the oral/alimentary, intranasal, intratracheal, intrapulmonary, intravaginal or intrarectal route. Administration to the respiratory tract can be accomplished by nebulizing or aerosolizing droplets, spraying or dry powder compositions using a pressurized container (such as with a suitable propellant such as dichlorodifluoromethane, propane, nitrogen and the like) or in an unpressurized applicator. One can also perform topical administration using transdermal means (such as patches and the like). In the context of the present invention, a preferred composition for intramuscular and subcutaneous routes is formulated.
[0115] The composition according to the present invention can be presented in various forms, such as solid, liquid or frozen. Solid compositions (such as dry powder or lyophilized) can be obtained through a process that involves vacuum drying and freeze drying. For mucosal administration, the compositions may be formulated as gastroresistant capsules and granules for oral administration, suppositories for rectal or vaginal administration, optionally in combination with absorption enhancers useful for increasing the pore size of mucous membranes. These absorption enhancers are typically substances that have structural similarities to the phospholipid domains of mucous membranes, such as sodium deoxycholate, sodium glycocholate, dimethylbetacyclodextrin, and lauryl-1-lysophosphatidylcholine).
[0116] The appropriate dosage can be adapted depending on several parameters, particularly the mode of administration; the composition used; the age, health and weight of the host organism; the nature and extent of symptoms; the type of concurrent treatment; the frequency of treatment; and/or the need for prevention or therapy. Further refinement of calculations necessary to determine the appropriate dosage for treatment is routinely performed by those skilled in the art, in light of the relevant circumstances. For general guidance, the appropriate dosage for a composition comprising virus ranges from about 105 to about 1013 vp (viral particles), iu (infectious units) or pfu (plaque forming units), depending on the vector and quantitative method used. . Available methods for assessing the amount of vp, iu, and pfu present in a sample are conventional in the art. The number of adenoviral particles (vp), for example, is usually determined by measuring A260 uptake, iu titers by quantitative DBP immunofluorescence, and pfu by counting the number of plaques after infection of permissive cells. Preferably, the vp/iu ratio is less than 100 as per FDA guidelines. Doses of about 5x105 to about 109 pfu are preferred for the MVA-based composition with specific preference for doses of about 107, about 5x107, about 108 or about 5x108 pfu. With respect to Ad-based compositions, preferred doses contain about 106 to about 1012 vp, with specific preference for doses of about 109, about 5x109, about 1010, about 5x1010 vp, or about 1011 vp. A composition based on vector plasmids can be administered in doses from 10 µg to 20 mg, conveniently from 100 µg to 2 mg. A protein composition may be administered in one or more doses of 10 ng to 20 mg, with special preference for a dosage of from about 0.1 µg to about 2 mg of therapeutic protein per kg of body weight. Administration can take place in a single dose or a dose repeated one or more times after a certain period of time.
[0117] The composition according to the present invention can be employed in methods of treating a number of diseases and pathological conditions, especially those caused or associated with an HBV infection. As used herein, the term "treatment" or "treating" encompasses prophylaxis and/or therapy. It is especially useful for the treatment of chronic HBV infections and/or liver damage in patients infected with HBV, including cirrhosis and liver cancer. Preferably, upon introduction into a host organism in accordance with the modalities described herein, the composition according to the present invention provides therapeutic benefit to the treated host compared to before treatment. The therapeutic benefit can be evidenced through a number of ways, such as reducing the HBV viral load detected in the blood, plasma, serum or liver of infected patients and/or through the detection of an anti-HBV immunological reaction (such as such as the production of anti-HBV antibodies and/or T cell-mediated immunity) or by delaying symptoms associated with HBV infections (such as delayed development of cirrhosis or liver cancer), or by reducing conditions of inflammation/steatosis /liver fibrosis typically associated with HBV infections or increased response of the individual to conventional therapies.
[0118] Consequently, the present invention also encompasses the use of at least one of the portions of HBV, nucleic acid molecules, vectors, infectious viral particles, host cells or compositions according to the present invention for the preparation of a drug intended for the treatment or prevention of HBV infections, pathological conditions and HBV-associated diseases, according to the modalities described herein.
[0119] The present invention also provides a method of treating or preventing HBV infections, particularly chronic HBV infections, pathological conditions and HBV-associated diseases, which comprises administering to human or animal organisms in need thereof a therapeutically effective amount of at least one of the portions of HBV, nucleic acid molecules, vectors, infectious viral particles, host cells or compositions according to the present invention.
[0120] The method or use according to the present invention comprises one or more administrations (1, 2, 3, 4, 5, 6, 7, 8, 9, 10 etc.) of a therapeutically effective amount of the(s) said active agent(s), wherein said administrations are separated from each other for an appropriate period of time and are conducted via the same route of administration or by different routes of administration (such as intramuscular and subcutaneous) by the same or different routes. Three administrations separated by three to ten days (such as three weekly administrations) are particularly suitable for vector(s) and MVA-based compositions. This first series of administration can be followed by one or more subsequent administrations, using the same active agent(s) which can take place in one or more months in order to recall the anti-immune immunological reaction. HBV primed by three sequential administrations. With respect to Ad-based compositions and vector(s), a preferred method or use includes an administration, eventually followed by one or two subsequent administrations one and six months later.
[0121] If desired, the method or use according to the present invention may be conducted in combination with one or more conventional therapeutic modalities (such as radiation, chemotherapy and/or surgery). The use of a variety of therapeutic approaches provides the patient with a broader-based intervention. In one embodiment, the method according to the present invention may be preceded or followed by a surgical intervention. In another embodiment, it may be preceded or followed by radiation therapy (such as gamma radiation). Those skilled in the art can easily formulate appropriate radiation therapy parameters and protocols that can be used (see, for example, Perez and Brady, 1992, Principles and Practice of Radiation Oncology, Second Edition, JB Lippincott Co.; using adaptations and modifications appropriate as will be readily evident to those skilled in the art).
[0122] In yet another embodiment, the method or use according to the present invention is associated with chemotherapy with one or more HBV drugs that are conventionally used for the treatment or prevention of HBV infections, HBV-associated diseases and pathological conditions . Its administration may precede, be simultaneous with or subsequent to administration of the active agent for use in the present invention. Representative examples of HBV drugs include, without limitation, polymerase inhibitors, RNase H inhibitors, nucleoside analogues, nucleotide analogues, TLR agonists, N-glycosylation inhibitors, siRNA, nonsense oligonucleotides, anti-HBV antibodies, modulators vaccines, therapeutic vaccines, and antitumor agents commonly used in the treatment of HBV-associated liver cancers (such as adriamycin, adriamycin with lipiodol or sorasenib). Examples of suitable therapeutic vaccines include, without limitation, recombinant antigens, VLPs, vectors or synthetic peptides based on or encoding HBV proteins (core, preS1, preS2, S and/or polymerase) that are particularly suitable for triggering a reaction anti-HBV humoral. These HBV drugs can be given as a single dose or, alternatively, in multiple doses according to standard protocols, dosages and regimens over several hours, days and/or weeks. A particularly suitable method or use in accordance with the present invention is employed in combination with the standard of care which may predate, parallel or subsequent to the method or use in accordance with the present invention. Although this standard of care may vary from patient to patient, it usually comprises treatment with cytokines (such as IFNa, pegylated IFNa2) and/or with nucleotide or nucleoside analogues such as lamivudine, entecavir, telbivudine, adefovir, dipivoxil, or tenofovir.
[0123] In another embodiment, the method or use according to the present invention is conducted in accordance with an incentive therapeutic modality with primers, which comprises sequential administrations of one or more primer compositions and one or more incentive compositions. Typically, primer and booster compositions utilize different vehicles that comprise or encode at least one antigenic domain in common. In addition, primer and booster compositions can be administered at the same or alternative locations by the same route or by different routes of administration. Polypeptide-based compositions, for example, can be administered mucosally, while vector-based compositions are preferably injected, such as via subcutaneous injection for an MVA vector, intramuscular injection for a DNA plasmid, and subcutaneous or intramuscular injection for an adenoviral vector.
[0124] The present invention also provides a method of inducing or stimulating an immune reaction against HBV in a host organism, which comprises administering to said organism at least one of the HBV portions, nucleic acid molecules, vectors, infectious viral particles, host cells or compositions according to the present invention, to induce or stimulate said immunological reaction. The immune reaction can be specific and/or non-specific, humoral and/or cellular and, in this context, it can be mediated by CD4+, CD8+ or both. The immune reaction is preferably a T cell reaction directed to an HBV antigen.
[0125] The ability of the method according to the present invention to induce or stimulate an anti-HBV immunological reaction upon administration in an animal or human organism can be evaluated in vitro or in vivo using a series of tests that are standard in the art. For a general description of available methods to assess the onset and activation of an immune reaction, see, for example, Coligan et al (1992 and 1994, Current Protocols in Immunology; Ed. J. Wiley & Sons Inc., National Institutes of Health). Measurement of cellular immunity can be performed by measuring cytokine profiles secreted by activated effector cells, including those derived from CD4+ and CD8+ T cells (such as quantifying IL-10 or IFNg producing cells via ELIspot) , determining the position of immune effector cell activation (such as T cell proliferation assays by classical [3H] thymidine uptake), antigen-specific T lymphocyte testing in a sensitized patient (such as peptide-specific lysis in a cytotoxicity test). The ability to stimulate a humoral reaction can be determined through antibody binding and/or competition in binding (see, for example, Harlow, 1989, Antibodies, Cold Spring Harbor Press). The method according to the present invention can be further validated in animal models challenged with an appropriate infectious agent or tumor inducing agent (such as a vaccinia virus or a Listeria monocytogenes bacterium expressing HBV gene products) to determine neutralization of the infectious agent or inducer of tumors and, eventually, partial resistance to associated symptoms, reflecting an induction or amplification of the anti-HBV immune reaction. Tests and validation of compositions according to the present invention are also illustrated in the Examples chapter below.
[0126] In another aspect, the present invention provides a kit of parts for use in the treatment or prevention of HBV infections, including chronic HBV infections, HBV-associated diseases and pathological conditions in accordance with the modalities described herein and, more specifically, for inducing or generating immunological reactions in patients infected with HBV, wherein said kit comprises a series of active agents selected from the group consisting of HBV portions, nucleic acid molecules, vectors, infectious viral particles, host cells and compositions described herein. Desirably, the aforementioned series of active agents is provided in the form of separate polypeptides or separate vectors and the administration of each of the active agents can take place simultaneously (at the same time) or separately (one after the other(s) after a certain time interval), by the same route or different routes of administration and at the same site (or close vicinity) or different sites, using the same dose or different doses.
Of specific interest in the present invention is a kit of parts comprising a first vector comprising a nucleic acid molecule encoding the polymerase portion as defined herein and a second vector comprising a nucleic acid molecule encoding the central portion and/or the env portion as defined herein.
[0128] According to a preferred embodiment, said first vector is an MVA vector which comprises a nucleic acid molecule placed under the control of a vaccinia promoter such as the 7.5K promoter and which encodes a polymerase portion comprising a sequence of amino acids as shown in SEQ ID No. 7, 8 or 9 or in SEQ ID No. 7 with the replacement of the Asp residue at position 494 by a His residue and the replacement of the Glu residue at position 672 by a His residue; and said second vector is an MVA vector which comprises a nucleic acid molecule placed under the control of a vaccinia promoter such as the pH5r promoter and which encodes a central portion and an env portion which comprises an amino acid sequence as shown in SEQ ID No. 18 or 19.
[0129] According to another preferred embodiment, said first vector is an adenovirus vector comprising a nucleic acid molecule placed under the control of an appropriate promoter, such as the CMV promoter, and encoding a polymerase portion comprising a amino acid sequence as shown in SEQ ID No. 7, SEQ ID No. 8 or SEQ ID No. 7 with the replacement of the Asp residue at position 494 by a His residue and the replacement of the Glu residue at position 672 by a His residue; and said second vector is an adenovirus vector which comprises a nucleic acid molecule placed under the control of an appropriate promoter such as the CMV promoter and which encodes a central portion and an env portion which comprises an amino acid sequence as shown in SEQ ID No. 18, 19 or 20 or the part of SEQ ID No. 20 starting at residue 1 and ending at residue 251 (core-env1-env2) or the part of SEQ ID No. 20 starting at residue 1 and ending at residue 221 (core-env1).
[0130] The kit of parts according to the present invention may further comprise a third vector that expresses an immunomodulator as defined above. For illustrative purposes, preferred doses of each active ingredient comprised in the kit of parts have the same order as described above with respect to the composition according to the present invention, with specific preference for a dose of 5 x 105 to 109 pfu for each MVA vector or poxvirus and about 106 to about 1012 vp for each adenoviral factor.
[0131] The present invention also provides antibodies that selectively bind to the HBV moieties in use in the present invention or its peptide fragments. As used herein, an antibody selectively binds a target peptide when it binds the target peptide and does not bind significantly to unrelated proteins. In certain cases, it would be understood that the antibody that binds to the peptide is still selective despite some degree of cross-reactivity. It is preferred, however, that the antibody according to the present invention does not bind with high affinity or high selectivity to native HBV protein.
[0132] As used herein, an antibody is defined in terms consistent with those recognized in the art. Antibodies in accordance with the present invention include polyclonal antibodies and monoclonal antibodies, as well as fragments of such antibodies, including, but not limited to, Fab, F(ab')2 and Fv fragments. Antibodies in accordance with the present invention can be produced using methods conventional in the art, such as after administering to an animal an effective amount of any of the HBV portions described herein and/or one of its peptide fragments. Antibodies are preferably prepared from discrete regions or fragments of the portions of HBV that comprise unique sequences, such as those directed to the modifications described herein and introduced into native HBV proteins.
[0133] Antibodies according to the present invention have a number of potential uses that are within the scope of the present invention. Such antibodies can be used, for example, (a) as reagents in tests to detect the first or second polypeptides in accordance with the present invention; (b) as reagents in tests to detect the presence of an HBV virus in a biological sample; and/or (c) as tools for recovering the recombinantly produced HBV portions from a mixture of proteins or other contaminants (such as allowing purification by affinity chromatography or immunoprecipitation from cultured host cells).
[0134] The present invention also relates to a method of detection and/or quantification of an HBV virus or an anti-HBV antibody in a biological sample (such as plasma, serum, tissue) taken from an individual susceptible to infection by the said HBV virus using at least one of the HBV portions, nucleic acid molecules, vectors, infectious viral particles, host cells, compositions or antibodies according to the present invention.
[0135] In one embodiment, the method is more particularly suitable for detection and/or quantification of an HBV virus in a biological sample and comprises at least the steps of placing said biological sample in contact with at least one of the antibodies according to the present invention under conditions which permit the formation of a complex between the virus and the antibody and the detection and/or quantification of the formation of said complex by any suitable means.
[0136] In another embodiment, the method is more particularly suitable for the detection and/or quantification of an anti-HBV antibody in a biological sample and comprises at least the steps of placing said biological sample in contact with at least one of the HBV portions, nucleic acid molecules, vectors, infectious viral particles, host cells, compositions according to the present invention under conditions that allow the formation of a complex between the anti-HBV antibody and the HBV portion, nucleic acid molecule , vector, infectious viral particle, host cell, composition according to the present invention and detection and/or quantification of the formation of said complex by any suitable means.
[0137] Those skilled in the art will readily determine the amount of antibody, HBV portion, nucleic acid molecule, vector, infectious viral particle, host cell or composition to be used in the methods according to the present invention. The means of detecting and/or quantifying the virus is routine and well known to those skilled in the art. By way of illustration, one can mention Blots, ELISA, so-called sandwich methods, competition methods and PCR methods, particularly so-called “real-time” methods. The use of an antibody, HBV portion, nucleic acid molecule, vector, infectious viral particle, host cell or composition according to the present invention as a reagent can be facilitated by coupling (i.e., physical binding) to a detectable substance. Examples of detectable substances include various enzymes (such as horseradish peroxidase, alkaline phosphatase, betagalactosidase or acetylcholinesterase), prosthetic groups (such as streptavidin/biotin or avidin/biotin), fluorescent materials (such as umbelliferone, fluorescein or fluorescein derivatives) , luminescent materials, bioluminescent materials (such as luciferase, luciferin or aequorin) and radioactive materials (such as 125I, 131I, 35S or 3H).
[0138] Finally, the present invention relates to the use of at least one of the portions of HBV, nucleic acid molecules, vectors, infectious viral particles, host cells, compositions or antibodies according to the present invention for in vitro diagnosis of HBV infections in biological samples.
[0139] The present invention has been described illustratively and it should be understood that the terminology that was used is intended to be in the nature of descriptive and non-limiting words. Obviously, many modifications and variations of the present invention are possible in light of the above teachings. It is to be understood, therefore, that, within the scope of the appended claims, the present invention may be practiced other than as specifically described herein.
[0140] All patent reports, publications and database entries mentioned above are specifically incorporated in their entirety by reference herein in the same manner as if each individual patent, publication or application were specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE FIGURES
[0141] Figure 1 illustrates the expression of HBV polypeptides from adenoviruses and cells infected with MVA. A549 cells or fibroblasts from chick embryos were infected at MOI 10 or 50 for adenovirus or MOI 0.2 or 1 for MVA and cells were lysed within 48 hours of infection. Western blotting was then performed with cell lysates obtained from cells infected with the various Ad (Figure 1A) and MVA (Figure 1B) constructs to detect specific HBV proteins. Core-containing polypeptides were detected using an anti-core antibody (C1-5 or 13A9, dilution 1/200) and polymerase-containing polypeptides with an anti-Pol antibody (8D5, dilution 1/200) as primary antibodies and the secondary antibody was coupled to HRP . The expected sizes of the proteins expressed by Ad TG17909 and Ad TG17910 are, respectively, 31.6 kDa and 88.5 kDa. The expected sizes of the proteins expressed by MVATG17971, MVATG17972, MVATG17993 and MVATG17994 are, respectively, 20.2 kDa, 15.8 kDa, 20 kDa and 23.5 kDa. The expected sizes of proteins expressed by MVATG17842 and MVATG17843 are 88.5 kDa and 98.2 kDa, respectively.
[0142] Figure 2 illustrates the immunogenicity of adenovirus encoded HBV polypeptides in IFNY Elispots assays. Five individual mice (HLA-A2 transgenic mice) were immunized once with Ad TG17909 alone (black bars), Ad TG17910 alone (white bars) or in combination (Ad TG17909 + Ad TG17910 (grey bars). Figure 2A illustrates specific reactions. of T cells targeting protein polyemrase using the HLA-A2 restricted peptide SLY (SEQ ID NO: 55) or an irrelevant one (not shown). Figure 2B illustrates specific T cell reactions targeting the core protein using the HLA restricted peptides -A2 FLP (SEQ ID NO 56) or ILC (SEQ ID NO 57) Figure 2C illustrates specific T cell reactions directed to Env domains using the restricted peptides HLA-A2 VLQ (SEQ ID NO 58), FLG (SEQ ID No.59) or GLS (SEQ ID No.60) Each bar represents an individual vaccinated mouse and the hatched bars represent the mean of each group. Results are displayed as the mean value of the number of spots observed for 106 spleen cells obtained from cavities in three copies. A reaction was considered positive if the number of spots was more than 50 spots per 106 cells (this cut is represented by a thick black line).
[0143] Figure 3 illustrates the immunogenicity of adenovirus vector encoded HBV polypeptides in intracellular cytokine stain tests. Five individual mice (HLA-A2 transgenic mice) were immunized once with AdTG17909 (Figure 3B), AdTG17910 (Figure 3A) or a combination of AdTG17909 and AdTG17910 (Figure 3C). Splenocytes were cultured for five hours with Golgi-Plug and in the presence of either HLA-A2 restricted peptide (SLY for Pol, FLP, ILC for center, VLQ, FLG and GLS for env) or an irrelevant one. The percentage of CD8+ cells producing cytokines (IFNg and/or TNFa) specific for each HLA-A2-restricted epitope was determined using ICS tests. Each bar represents an individual vaccinated mouse, where IFNg-producing cells are represented by a black bar, TNFa-producing cells by a white bar, and IFNg + TNFa-producing cells by a hatched bar, and all these cell populations are stacked for each mouse .
[0144] Figure 4 illustrates the ability of HBV polypeptides encoded by the adenovirus vector to induce CD8 and CD4 T cell reactions, detected by means of intracellular cytokine stain tests. Five individual mice (HLA-A2 transgenic mice) were immunized once with a mixture of AdTG17909 and AdTG17910. Splenocytes were cultured for five hours with Golgi-Plug in the presence of either HLA-A2 restricted peptide (SLY for Pol, FLP, ILC for center, VLQ, FLG and GLS for Env) or sets of overlapping polypeptides (15aa by eleven overlap amino acids, two sets of peptides for the center and two sets of peptides for env) that cover the entire antigenic domains or an irrelevant peptide. Specific induced CD8 T cells producing IFNgamma and/or TNFalpha (Figure 4A) and specific induced CD4 T cells producing IFNgamma and/or TNFalpha (Figure 4B) or producing IFNgamma and/or IL2 (Figure 4C) were monitored by means of ICS tests. Each bar represents an individual vaccinated mouse, with IFNg producing cells represented by a gray bar, TNFa or IL2 producing cells by a white bar, and IFNg + TNFa or IFNg + IL2 producing cells by a hatched bar, and all of these cell populations are stacked for each mouse. The average for each group is also displayed.
[0145] Figure 5 illustrates the ability of adenovirus vector encoding HBV polypeptides to induce functional cytolysis in vivo against target cells loaded with HLA-A2 restricted epitopes of HBV. Three individual mice (HLA-A2 transgenic mice) were immunized once with a combination of AdTG17909 and AdTG17910 (M1 to M3) and one mouse was immunized once with an empty adenovirus vector as a negative control (M0). CFSE-stained splenocytes from syngeneic mice, loaded with HBV HLA-A2 epitopes or not (negative control) were injected intravenously into vaccinated mice. In vivo lysis of stained cells was determined for each mouse 24 hours later by flow cytometry and calculated as indicated in Materials and Methods. The mean of the specific lysis observed for each peptide for the three mice vaccinated with AdHBV was calculated and displayed (mean M1-M3).
[0146] Figure 6 illustrates the immunogenicity of MVA vector encoded HBV polypeptides as determined by IFNgamma Elispots assays. Individual mice (HLA-A2 transgenic mice) were immunized three times at an interval of one week with MVATG17842 or MVATG17843 (Figure 6A) or MVATG17971 (Figure 6B) or MVATG17972 or the negative control MVATGN33.1 (data not shown). Figure 6A illustrates specific T cell-targeted reactions to protein polymerase after immunization with MVATG17842 (dark gray bars) or MVATG17843 (light gray bars) using the HLA-A2 restricted peptide SLY (SEQ ID NO: 55), set 8 peptides which cover the C-terminal part of the protein polymerase (25 peptides of fifteen amino acids overlapping by eleven amino acids per set), a medium or irrelevant peptide (negative controls). Figure 6B illustrates core protein-targeted specific T cell reactions after immunization with MVATG17971 using the HLA-A2 FLP (SEQ ID NO. 56), ILC (SEQ ID NO. 57) restricted peptides sets "center 1 and 2” center (21 to 22 peptides with fifteen amino acids overlapping by eleven amino acids per set), a medium or irrelevant peptide (negative controls). Each bar represents an individual vaccinated mouse and the hatched bars represent the mean of each group. The results are displayed as the mean value of the number of spots observed for 106 spleen cells, obtained from containers in three copies. The reaction was considered positive if the number of spots was more than 50 spots per 106 cells (this cut is represented by a black dotted line).
[0147] Figure 7 illustrates the immunogenicity of HBV polypeptides encoded by MVA vectors co-injected into mice, as determined using IFNgamma Elispots assays. Individual mice (HLA-A2 transgenic mice) were immunized three times every week with a mixture of MVATG17843 and MVATG17972 (Figure 7A), MVATG17993 (Figure 7B) or MVATG17994 (Figure 7C) or with MVATGN33.1 alone as a control negative (data not displayed). Specific T cell reactions targeting protein polymerase were determined using the HLA-A2 SLY restricted peptide (SEQ ID NO 55) and specific T cell reactions targeting Env domains using the HLA-A2 GLS restricted peptide (SEQ ID NO ° 60) or a set of peptides that cover the Env2 domain (set of peptides fifteen amino acids long overlapped by eleven amino acids). Irrelevant medium and peptide were used as negative controls. Each bar represents an individual vaccinated mouse and the hatched bars represent the mean of each group. The results are displayed as the mean value of the number of spots observed for 106 spleen cells, obtained from wells in three copies. A reaction was considered positive if the number of spots was more than 92 spots per 106 cells (this cutoff is represented by a black dotted line). EXAMPLES 1. MATERIALS AND METHODS:
[0148] The constructions described below are conducted according to general methods of genetic engineering and molecular cloning detailed in Maniatis et al (1989, Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York) or according to the recommendations manufacturer when using a commercial kit. PCR amplification methods are known to those skilled in the art (see, for example, PCR Protocols - A Guide to Methods and Applications, 1990, published by Innis, Gelfand, Sninsky and White, Academic Press). Recombinant plasmids carrying the ampicillin resistance gene are bred in E. coli C600 (Stratagene) on liquid medium or agar supplemented with 100 µg/ml of antibiotic. The constructions of the recombinant vaccinia viruses are carried out according to conventional technology in the field of documents mentioned above and in Macett et al (1982, Proc. Natl. Acad. Sci. USA 79, 7415-7419) and Macett et al (1984) , J. Virol. 49, 857-864). The selection gene gpt (xanthine guanine phosphoribosyltransferase) from E. coli (Falkner and Moss, 1988, J. Virol. 62, 1849-1854) is used to facilitate the selection of recombinant vaccinia viruses. 1.1 VECTOR PRODUCTION AND CONSTRUCTIONS. 1.1.1 SELECTED ANTIGENS AND HBV SEQUENCE LINEAGE.
[0149] The vectors exemplified below were designed to express the polymerase, central polypeptides and immunogenic domains of the envelope protein. All of them originate from the HBV Y07587 lineage whose sequence is described in international databases (Genbank Y07587) and in different publications. It is a genotype D virus of serotype ayw.
[0150] The core polypeptide is either wild-type (aa 1-183) or a core polypeptide excluding amino acids 77 to 84 (ie the core containing amino acids 1 to 76 and 85 to 183 is called the core*) or a C-terminally truncated polypeptide (1-148) or a C-terminally truncated core (1-148) with additional exclusion of amino acids 77 to 84 (i.e., the core containing amino acids 1 to 76 and 85 to 148 is called nucleus*t).
[0151] Polymerase polypeptide is a wild-type or N-terminally truncated polypeptide that does not contain the first 47 amino acids (48-832) or an N-truncated polymerase (48-832) that has undergone additional mutation at position 540 ( D in H) and 718 (E in H) (where positions 450 and 718 are given with respect to the wild-type polymerase) or the truncated (48-832) and mutated polymerase (D540H and E718H) which is fused to the transmembrane and signal peptide domain of the rabies virus glycoprotein (Pol*TMR).
[0152] The selected Env domains are: domain from amino acids 14 to 51 of protein S (Env 1) and domain from amino acids 165 to 194 of protein HBs (Env2) and domain from amino acid 202 to 226 of protein HBs (Env 4). 1.1.2 CONSTRUCTION AND PRODUCTION OF AN MVATG17842 EXPRESSING A TRUNCATED AND MUTTED HBV POLYMERASE (POL*).
[0153] The nucleotide sequences encoding a modified HBV polymerase polypeptide were synthesized by the company Geneart using synthetic oligonucleotides and PCR products. The modified HBV polymerase corresponds to the HBV polymerase protein Y07587 (SEQ ID NO: 1) which was mutated at position 540 (D to H) and 718 (E to H) in order to eliminate the activities of Rnase H and RTase displayed by the native HBV polymerase (which results in the amino acid sequence shown in SEQ ID No. 8 and the nucleotide sequence shown in SEQ ID No. 22). The reassembled pol sequence was then cloned into a plasmid vector, which results in PGA15-pol (SEQ ID NO:27). A truncated version excluding the first 47 amino acids present at the N-terminus of the native HBV polymerase was amplified by PCR from plasmid pGA15-Pol using the following primers: OTG19037 (GAGCGATATCCACCATGAATGTTAGTATTCCTTGGAC) (SEQ ID NO: 28) and OTG19038 (GATCGCTAGCTCACGGTGGTCTCCATGCGAC) (SEQ ID NO:29). The resulting fragment was inserted into the NheI and EcoRV restriction sites of an MVA transfer plasmid downstream of the p7.5K promoter (Cochran et al, 1985, J. Virol., 54:30), which results in pTG17842. The truncated and mutated polymerase is hereinafter called pol*.
[0154] The MVA transfer plasmid is designed to allow the insertion of the nucleotide sequence to be transferred via homologous recombination in deletion III of the MVA genome. It originates from plasmid pTG1E (described in Braun et al, 2000, Gene Ther. 7: 1447) in which the side sequences (BRG3 and BRD3) were cloned around the MVAIII deletion (Sutter and Moss, 1992, Proc. Natl Acad. Sci. USA 89: 10847). The transfer plasmid also contains a fusion between the amplified green fluorescent protein Aequorea victoria (eGFP gene, pEGP-C1 isolate, Clontech) and the Escherichia coli xanthine guanine phosphoribosyltransferase gene (gpt gene) under the control of the synthetic promoter of the Escherichia coli virus early posterior vaccinia p11K7.5 (kindly provided by R. Wittek, University of Lausanne). Synthesis of xanthine guanine phosphoribosyltransferase allows recombinant MVA GPT+ to form plaques on a selective medium containing mycophenolic acid, xanthine and hypoxanthine (Falkner et al, 1988, J. Virol. 62, 1849-54) and eGFP allows the visualization of plaques of recombinant MVA. The eGFP-GPT selection marker is placed between two homologous sequences in the same orientation. Once clonal selection is achieved, the selection marker is easily eliminated by several passages without selection, which allows the growth of recombinant MVA eGFP-GPT.
[0155] The generation of MVATG17842 virus was performed by homologous recombination in primary chicken embryo fibroblasts (CEF) infected with MVA and transfected with pTG17842 (according to standard calcium phosphate DNA precipitation). Viral selection was performed through three rounds of plaque purification in the presence of a selective medium containing mycophenolic acid, xanthine and hypoxanthine. As mentioned above, the selection marker was then eliminated by passing through a non-selective medium. There was no contamination by parental MVA through PCR.
[0156] Analysis of the expression of HBV polymerase was performed by means of Western Blot. A549 cells (ATCC CCL-185) were infected at MOI of 1 with MVATG17842 (Pol*) in the presence or absence of MG-132 proteasome inhibitor (10 µM) added to the growth medium. After 24 hours, cells were harvested. Western blot analysis was performed using commercial monoclonal anti-Pol antibody Hep B Pol (8D5, Santa Cruz, no. sc-81591). 1.1.3 CONSTRUCTION AND PRODUCTION DEMVATG17843 EXPRESSING A TRUNCATED AND MUTTED HBV POLYMERASE, FUSED TO THE ANCHORAGE DOMAIN OF ANGER ENVELOPE GLYCOPROTEIN (POL*TMR).
[0157] The HBV Pol* sequence was then modified by fusing at its N-terminus to a signal peptide (SS) and at its C-terminus to a membrane anchoring sequence (TMR) derived from the glycoprotein from rabies virus (isolated from ERA; described in Genbank No. M38452). The SS and TMR sequences were amplified from plasmid pTG8042 (described in WO 99/03885) by PCR using, respectively, the primer pairs OTG19045 (SEQ ID N° 30) (GAGTGATATCCACCATGGTTCCTCAGGCTCTCCTG) / OTG19047 (SEQ ID N° 30) No. 31) (GTCCAAGGAATACTAACATTAATAGGGAATTTCCCAAAACACAATG) and OTG19049 (SEQ ID No. 32) (GTCGCATGGAGACCACCGTATGTATTACTGAGTGCAGGG / OTG19050 (SEQ ID No. 33) (GAGTGCTAGCTCACAGTCTGGTCTCACCC) (GAGTGCTAGCTCACAGTCTGGTCTCACCC PCR plasmid). of primers OTG19046 (SEQ ID NO. 34) (GTTTTGGGAAATTCCCTATTAATGTTAGTATTCCTTGGACTC) / OTG19048 (SEQ ID NO. 35) (CTGCACTCAGTAATACATACGGTGGTCTCCATGCGACGTGC) Then, the SS-Pol*-TMR sequence was reassembled using the PCR primer means. : OTG19045 (SEQ ID NO:30) and OTG19050 (SEQ ID NO:33) The resulting fragment was inserted into the NheI and EcoRV restriction sites of a vaccinia transfer plasmid downstream of the p7.5K promoter (Coch ran et al, 1985, J. Virol. 54:30), which results in pTG17843.
[0158] The generation of MVATG17843 virus was performed in CEF by means of homologous recombination as described above.
[0159] Pol*-TMR analysis was performed by Western Blot. A549 cells were infected at MOI 1 with MVATG17843 in the presence or absence of MG-132 proteasome inhibitor (10 µM) added to growth medium. After 24 hours, cells were harvested. Western blot analysis was performed using commercial monoclonal anti-Pol antibody Hep B Pol (8D5, Santa Cruz, no. sc-81591). 1.1.4 CONSTRUCTION AND PRODUCTION OF MVATG17971 WHICH EXPRESSES A DELETED CENTRAL POLYPEPTIDE (NUCLEUS*).
[0160] Core* corresponds to the core sequence of HBV Y07587 (SEQ ID NO:2) with amino acids 77 to 84 deleted.
[0161] The Nucleus* coding sequences were reconstituted by means of double PCR from the central plasmid of pGA4. This plasmid was made by the Geneart company. It contains a full-length coding sequence of the HBV core gene that has been assembled with synthetic oligonucleotides and/or PCR products. The last two CAA TGT codons of the coding sequence were modified in CAG TGC to avoid sequence homology with Pol (SEQ ID NO:36).
[0162] The core sequence of positions 1 to 76 was amplified by PCR using the following primers OTG19290 (SEQ ID NO 37) (GACTGTTAACCACCATGGACATTGATCCTTATAAAGAATTTG) and OTG19292 (SEQ ID NO 38) (GTTGACATAACTGACTACCAAATTACCACCCACCCAGGTAG). The central sequence of positions 85 to 183 was amplified by PCR with the following primers: OTG19291 (SEQ ID NO 39) (GTGGGTGGTAATTTGGTAGTCAGTTATGTCAACACTAATATG) and OTG19080 (SEQ ID NO 61) (GACTCTCGAGTTAGCACTGAGATTCCCGAGATTG). Double PCR was performed using OTG19290 (SEQ ID NO 37) and OTG19080 (SEQ ID NO 61) and the latter two generated amplicons. The resulting fragment was inserted into the XhoI and HpaI restriction sites of a vaccinia transfer plasmid down-stream of the pH5R promoter (Rosel et al, 1986, J. Virol. 60:436), which results in pTG17971.
[0163] The generation of the MVATG17971 virus was performed in CEF by means of homologous recombination as described above.
[0164] Analysis of Nucleus* expression was performed by means of Western Blot. Chicken embryo fibroblasts were infested at 0.2 MOI with MVATG17971. After 24 hours, cells were harvested. Western blot analysis was performed using a commercial anti-core monoclonal antibody Hep B cAg (13A9) (Santa Cruz, no. sc-23946). 1.1.5 CONSTRUCTION AND PRODUCTION DEMVATG17972 WHICH EXPRESSES A DELETED AND TRUNCATED CENTRAL POLYPEPTIDE (NUCLEUS*T).
[0165] Nucleus*t corresponds to the core sequence of HBV Y07587 (SEQ ID No. 2) truncated after amino acid 148 and with amino acids 77 to 84 deleted.
[0166] The Core*t coding sequences were reconstituted by means of double PCR from plasmid pGA4-Core which contains the sequence encoding the full-length HBV core gene that was assembled from synthetic oligonucleotides and products of PCR, except for the modification of the last two CAA TGT codons of the coding sequence by CAG TGC to avoid sequence homology with Pol (SEQ ID NO:36).
[0167] The core sequence of positions 1 to 76 was amplified by PCR using the following primers: OTG19290 (SEQ ID NO 37) (GACTGTTAACCACCATGGACATTGATCCTTATAAAGAATTTG) and OTG19292 (SEQ ID NO 38) (GTTGACATAACTGACTACCAAATTACCACCCACCCAGGTAG). The central sequence of positions 85 to 148 was amplified by PCR from pGA4-core with the following primers: OTG19291 (SEQ ID NO. 39) (GTGGGTGGTAATTTGGTAGTCAGTTATGTCAACACTAATATG) and OTG19299 (SEQ ID NO. 40) (GACTCTCGAGTTTCAGAGAGTAG). Double PCR was performed using OTG19290 (SEQ ID NO 37) and OTG19299 (SEQ ID NO 40). The resulting fragment was inserted into the XhoI and HpaI restriction sites of a vaccinia transfer plasmid down-stream of the pH5R promoter (Rosel et al, 1986, J. Virol. 60:436), resulting in pTG17972.
[0168] The generation of MVATG17972 virus was performed in CEF by means of homologous recombination as described above.
[0169] Analysis of the expression of Nucleus*t was performed by means of Western Blot. Chicken embryo fibroblasts were infected at MOI 0.2 with MVATG17972. After 24 hours, cells were harvested. Western blot analysis was performed using a commercial anti-core monoclonal antibody Hep B cAg (13A9) (Santa Cruz, no. sc-23946). 11.6 CONSTRUCTION AND PRODUCTION DEMVATG17993 WHICH EXPRESSES A DELETED AND TRUNCATED CENTRAL POLYPEPTIDE FUSIONED TO THE ENV1 IMMUNOGENIC DOMAIN (NUCLEUS*T-ENV1).
[0170] The Core-t* portion has been fused to the Env1 domain that extends from amino acids 14 to 51 of the HBs protein.
[0171] The Nucleus*t-Env1 sequence was reconstituted by means of double PCR. The Nucleus*t sequence was amplified by PCR from pTG17972 using the following primers: OTG19317 (SEQ ID NO 41) (GACGGGATCCACCATGGACATTGATCCTTATAAAGAATTTGG) and OTG19319 (SEQ ID NO 42) (GCCTGCTTGCAGGACAACAGTAGTCCGGAAGTGTTG). The Env1 sequence was amplified by PCR from plasmid pMK-C/E (SEQ ID No. 43) using the following primers: OTG19318 (SEQ ID No. 44) (CCGGAGACTACTGTTGTCCTGCAAGCAGGCTTCTTC) and OTG19320 (SEQ ID No. 45) ) (GAGTCATTCTCGACTTGCGGCCGCTTACTGACCCAGGCAAACCGTGG ). Double PCR was performed using OTG19317 (SEQ ID No. 41) and OTG19320 (SEQ ID No. 45). The resulting fragment was inserted into the BamHI and NotI restriction sites of a vaccinia transfer plasmid down-stream of the pH5R promoter (Rosel et al, 1986, J. Virol. 60:436), resulting in pTG17993.
[0172] For illustrative purposes, plasmid pMK-C/E was elaborated by Geneart and contains a chimeric sequence consisting of an insertion of three HBV env domain sequences in the core sequence (SEQ ID No. 43). The native env and central nucleotide sequences were degenerate to avoid sequence homology to the HBV Pol sequence and also sequence instability due to polyT or polyGC stretches. In addition, the core sequence has been deleted from amino acids 77 to 84 and truncated to aa148. The selected Env domains are: domain from amino acids 14 to 51 of protein S (Env 1) and domain from amino acids 165 to 194 of protein S (Env 2) and domain from amino acids 202 to 226 of protein S (Env 4). The three domains were inserted, respectively, at positions nt 127, at nt 222 and at nt 416 of the core sequence. It should be noted that insertion of this sequence into an MVA vector results in cytotoxicity of the expressing cells, emphasizing the fact that the design of the env-center fusion is not straightforward.
[0173] The generation of the virus MVATG17993 in CEF was carried out by means of homologous recombination as described above.
[0174] Analysis of the expression of Nucleus*t-env1 was performed using Western Blot. Chicken embryo fibroblasts were infected at MOI 0.2 with MVATG17993. After 24 hours, cells were harvested. Western blot analysis was performed using a commercial anti-core monoclonal antibody Hep B cAg (13A9) (Santa Cruz, no. sc-23946). 1.1.7 CONSTRUCTION AND PRODUCTION DEMVATG17994 WHICH EXPRESSES A DELETED AND TRUNCATE CENTRAL POLYPEPTIDE FUZZED TO THE ENV1 AND ENV2 IMMUNOGENIC DOMAINS (NUCLEUS*T-ENV1-ENV2).
[0175] The Nucleus*t polypeptide described in 1.1.5 was then fused to two immunogenic domains extending from amino acids 14 to 51 (Env 1) and from amino acids 165 to 194 (Env 2) of the HBs protein.
[0176] The nucleotide sequences encoding the Nucleus*t-Env1-Env2 were reassembled by means of triple PCR. The Nucleus*t sequence was amplified by PCR from pTG17972 using the following primers: OTG19317 (SEQ ID No. 41) and OTG19319 (SEQ ID No. 42). Env1 was amplified from plasmid pMK-C/E using the following primers: OTG19318 (SEQ ID No. 44) and OTG19322 (SEQ ID No. 46 (GCGTGCGCTTGCCACTGACCCAGGCAAACCGTGG) Env2 was amplified from plasmid pMK-C/E using the following primers: OTG19321 (SEQ ID No. 47 (CGGTTTGCCTGGGTCAGTGGGCAAGCGCACGCTTTAGC) and OTG19323 (SEQ ID No. 48) (GAGTCATTCTCGACTTGCGGCCGCTTACACGCTCAGCCACACGGTTG G). °48) The resulting fragment was inserted into the BamHI and NotI restriction sites of a vaccinia transfer plasmid down-stream of the pH5R promoter (Rosel et al, 1986, J. Virol. 60:436), resulting in pTG17994.
[0177] The generation of the virus MVATG17994 in CEF was carried out by means of homologous recombination as described above.
[0178] Analysis of Nucleus*t-env1-env2 was performed by means of Western Blot. Chicken embryo fibroblasts were infected at MOI 0.2 with MVATG17994. After 24 hours, cells were harvested. Western blot analysis was performed using a commercial anti-core monoclonal antibody Hep B cAg (13A9, Santa Cruz, no. sc-23946). 1.1.8 CONSTRUCTION AND PRODUCTION OF AN ADENOVIRAL VECTOR ADTGI7909 THAT EXPRESSES NUCLEUS-ENV1-ENV2-ENV4:
[0179] A synthetic gene (831 nucleotides) encoding a Nucleus-Env1-Env2-Env4 fusion was reconstituted by means of double PCR. The Core was amplified by means of PCR from pGA4-Core (described in 1.1.4) using the following primers: OTG19152 (SEQ ID NO. 49) (GGGGGGCTAGCAAGCTTCCACCATGGACATTGATCCTTATAAAGAATT TG) and OTG19154 (SEQ ID NO. 50) (GAAAGATTGAACGGGCACTTGCTTG ). Env1-Env2-Env4 were amplified by PCR from pGA4-Env using the following primers: OTG19153 (SEQ ID NO.51) (CTCAATCTCGGGAATCTCAGTGCGTCCTGCAAGCTGGATTCTTTC) and OTG19159 (SEQ ID NO.52) (GAGTCATTCTCGACTTGCGCACGCTCATAG). Double PCR was performed using OTG19152 (SEQ ID No. 49) and OTG19159 (SEQ ID No. 52). The resulting fragment was inserted into the NheI and NotI restriction sites of an adenoviral booster plasmid that contains a CMV-driven expression pool surrounded by adenoviral sequences (adenoviral nucleotides 1-454 and nucleotides 3513-5781, respectively) to allow genome generation vector via homologous recombination (Chartier et al, 1996, J. Virol. 70:4805). The resulting adenoviral vector pTG17909 has E3 (nucleotides 2859330464) and E1 (nucleotides 455-3512) deleted, in which the E1 region is replaced by the expression set that contains, from 5' to 3', the CMV immediate early promoter/amplifier, a chimeric human IgG/β-globin intron (as found in the pCI vector available from Promega), where the sequence encodes Nucleus-Env1-Env2-Env4 and the posterior polyadenylation signal SV40. Recombinant adenovirus was generated by transfection of linearized PacI viral genomes into an E1 complementing cell line. Virus propagation, purification and titration were carried out as previously described (Erbs et al, 2000, Cancer Res. 60: 3813).
[0180] The expression of the fusion protein was evaluated by means of Western Blot. 106 A549 cells (ATCC CCL-185) were infected at MOI of 10 or 50 for 48 hours with AdTG17909 or with an empty adenovirus as a negative control. Cell pellets were collected and probed with an anti-core mouse monoclonal antibody (C1-5, sc-23945, Santa Cruz). 1.1.9 CONSTRUCTION AND PRODUCTION OF THE ADTG17910 ADENOVIRAL VECTOR THAT EXPRESSES POL*.
[0181] The gene encoding Pol*, a truncated polymerase protein of the first 47 amino acids, except the primer Met (48 to 832) and mutated at position 540 (D to H) and 718 (E to H) (with wild-type polymerase) was inserted into an adenovirus vector. The Pol gene (2364 nucleotides) was amplified by PCR from pGA15-Pol (described in 1.1.2) using primers OTG19155 (SEQ ID NO. 53) (GGGGGGCTAGCAAGCTTCCACCATGAATGTTAGTATTCCTTGGACT CATAAG) and OTG19156 (SEQ ID NO. 54) (GAGTCATTCTCGACTTGCGGCCGCTCACGGTGGTCTCCATGCGAC GTGC). The resulting fragment was inserted into the NheI and NotI restriction sites of an adenoviral booster plasmid that contains a CMV-driven expression pool surrounded by adenoviral sequences (adenoviral nucleotides 1-454 and nucleotides 3513-5781, respectively) to allow genome generation of vector by homologous recombination (Chartier et al, 1996, J. Virol. 70:4805). The resulting adenoviral vector pTG17910 has E3 (nucleotides 2859330464) and E1 (nucleotides 455-3512) deleted, with the E1 region replaced by the expression set that contains, 5' to 3', the CMV immediate early promoter/amplifier, a chimeric human IgG/β-globin intron (as found in the pCI vector available from Promega), where the sequence encodes the mutated truncated Pol and the SV40 posterior polyadenylation signal. Recombinant adenovirus was generated by transfection of the linearized PacI viral genomes into an E1 complementing cell line. Virus propagation, purification and titration were performed as described previously (Erbs et al, 2000, Cancer Res. 60: 3813).
[0182] The expression of the fusion protein was evaluated in adenovirus infected cells by means of Western Blot. A549 cells (106 cells) (ATCC CCL-185) were infected at an MOI of 10 or 50 for 48 hours with the AdTG17910 adenovirus as well as an empty adenovirus as a negative control. Cell pellets were collected and probed with an anti-Pol mouse monoclonal antibody (8D5, sc-81591, Santa Cruz). 1.2 ANTIGEN IMMUNOGENICITY ASSESSMENT.
[0183] The immunogenicity of antigens was assessed in vivo using intracellular cytokine stain (ICS) and Elispot IFNY tests after immunization of HLA transgenic mice. 1.2.1 MICE MODEL.
[0184] The HLA-A2.1 transgenic mice used in the study were described by Pascolo et al (1997, J. Exp. Med. 185: 2043). These mice have knockout murine H-2Db and β2-microglobulin genes and express a transgenic monochain histocompatibility class I molecule (HHD molecule) in which the C-terminus of human β2m is covalently linked to the N-terminus of a heavy chain chimeric (HLA-A*0201 α1-α2, transmembrane and intracytoplasmic domains H-2Db α3). Seven to ten week old mice (male and female) were immunized. The average weight of mice was about 25 to 30 g. 1.2.2 IMMUNIZATION PROTOCOLS.
[0185] The mice were divided into four groups: group 1 immunized by AdTG17909 (encoding HBV Center fused to immunogenic domains of env1, env2 and env4), group 2 immunized by AdTG17910 (encoding the mutated truncated Pol*) , group 3 immunized by the two vectors and group 4 immunized with an empty adenovirus (AdTG15149) as negative control. All animals were immunized by subcutaneous injection at the base of the tail, animals in groups 1 and 2 received a subcutaneous injection of 108 IU of each adenovirus (TG17909 or TG17910), group 3 received a subcutaneous injection of a mixture containing 108 IU of each adenovirus (2 x 108 IU total: 108 IU AdTG17909 + 108 IU AdTG17910) and negative controls received a subcutaneous injection of 2 x 108 IU AdTG15149. Cellular immune reactions were determined using intracellular cytokine stain (ICS) and IFNg Elispot tests two weeks after immunization. 1.2.3 PEPTIDES.
[0186] The peptides used for cellular stimuli in vitro were short peptides with nine to ten amino acids that are described or predicted as HLA-A2 restricted epitopes or long peptides with fifteen amino acids included in peptide libraries that cover all the antigens of interest.
[0187] Short peptides corresponding to described or predicted HLA-A2 restricted epitopes of polymerase protein, core protein or Env domains were synthesized by Eurogentec (Belgium) and dissolved in 100% DMSO (Sigma, D2650) at a concentration of 10 mM.
[0188] Peptide libraries covering the entire polymerase, core and envelope proteins were synthesized by ProImmune (Oxford, UK). The Pol, Central and Env libraries were composed of fifteen mer peptides overlapped by eleven amino acids. Each crude peptide was dissolved in 100% DMSO (Sigma, D2650) at a concentration of 50 mg/ml. For each library, peptides were pooled to a concentration of 2 mg/ml per peptide. - the HBV Pol protein is covered by eight sets of 24 to 25 peptides from the Pol library (Set 1: 24 peptides covering residues 45 to 151; Set 2: 24 peptides covering residues 140 to 251; Set 3: 24 peptides covering residues 241 to 347; Set 4: 24 peptides covering residues 337 to 447; Set 5: 24 peptides covering residues 437 to 543; Set 6: 24 peptides covering residues 533 to 639; 7: 24 peptides covering residues 629 to 735; Set 8: 25 peptides covering residues 725 to 832); - the HBV core protein is covered by two sets of 21 to 22 peptides from the core library (Set 1: 22 peptides covering residues 1 to 100; Set 2: 21 peptides covering residues 89 to 183); - the HBV Env protein is covered by three sets of six to ten peptides from the Env library (Set 1: ten peptides covering HBs residues 9 to 59; Set 2: nine peptides covering HBs residues 157 to 194; Set 4: six peptides covering HBs residues 193 to 226). 1.2.4 IFNG ELISPOT TESTS.
[0189] Splenocytes from immunized mice were collected and red blood cells were lysed (Sigma, R7757). 2 x 105 cells per well were cultured in three copies for forty hours in Multiscreen plates (Millipore, MSHA S4510) coated with a mouse anti-IFNY monoclonal antibody (BD Biosciences; 10 μg/ml, 551216) in MEM culture medium (Gibco , 22571) supplemented with 10% FCS (Sigma F7524 or JRH, 12003-100M), 80 U/ml penicillin/80 µg/ml streptomycin (PAN, P06-07-100), 2 mM L-glutamine ( Gibco, 25030), 1X non-essential amino acids (Gibco, 11140), 10 mM Hepes (Gibco, 15630), 1 mM sodium pyruvate (Gibco, 31350) and 50 μM β-mercaptoethanol (Gibco, 31350) and na presence of 10 units/ml of recombinant murine IL2 (Peprotech, 212-12), alone as a negative control or with: - 10 μM of an HLA-A2 restricted peptide present in Ad vector-encoded HBV antigens (SLY in Pol, FLP , ILC for Core, VLQ, FLG and GLS for Env) or an irrelevant one; - a set of peptides at a final concentration of 5 μg/ml per peptide; - 5 μg/ml of Concanavalin A (Sigma, C5275) for positive control.
[0190] IFNg-producing T cells were quantified by Elispot assay (cytokine-specific enzyme-linked immunoblots) as previously described (Himoudi et al, 2002, J. Virol. 76: 12735). The number of spots (corresponding to IFNg-producing T cells) in negative control wells was subtracted from the number of spots detected in experimental wells containing HBV peptides. Results are displayed as the mean value obtained for wells in three copies. An experimental threshold of positivity for observed reactions (or cut-off) is determined by calculating a threshold value that corresponds to the mean spotting value observed with medium alone + two standard deviations, reported for 106 cells. A technical cutoff linked to the CTL Elispot reader was also defined as being 50 spots/106 cells (which is the value above which the reader CV was systematically less than 20%). The highest value between the technical cutoff and the experimental limit calculated for each experiment is taken into account to define the cutoff value for each experiment. Statistical analyzes of Elispot reactions were conducted using a Mann-Whitney test. A p value equal to or less than 0.05 was considered significant. 1.2.5 T EST OF INTRACELLULAR CYTOKINE STAIN (ICS).
[0191] ICS was performed on splenocytes from each animal in each group. After lysis of red blood cells with lysis buffer (Sigma, R7757), 2 x 106 cells per well in 96-well flat-bottom plates were incubated in MEM alpha complete culture medium (Gibco BRL, 22571) in the presence of 10 units/ml of recombinant murine IL-2 (Peprotech, 212-12) isolated as a negative control or with 10 μM of specific HBV peptide or with a set of peptides at a final concentration of 5 μg/ml per peptide or with 10 μM of a irrelevant peptide. GolgiPlug (BD Biosciences, 555029) was added immediately at a final concentration of 1 µl/ml for five hours. Cells were then harvested into 96-well V-bottom plates and washed with 1% FCS-PBS. Blots were performed using monoclonal antibodies against CD3 (anti-CD3e-PE from hamster MAb, dilution 1/200), CD8 (anti-CD8a-APC from mouse MAb, dilution 1/600) and CD4 (anti-CD4-PerCP of rat MAb, 1/600 dilution) (all from BD Biosciences, 553063, 553035 and 553052, respectively) in 50 µl of 1% FCS-PBS for fifteen minutes at room temperature. After washing, cells were fixed and permeabilized with Cytofix/Cytoperm and washed with wash/Perm solution (BD Biosciences, 554714). Then mouse anti-IFNg-PE antibodies (BD Biosciences, 554412557724) and mouse anti-TNFα-Alexa488 antibodies (BD Biosciences, 557719) or mouse anti-IFNg-PE antibodies (BD Biosciences, 55441255772) and Anti-mouse IL2-Alexa488 antibodies (BD Biosciences, 557719) were added for fifteen minutes at room temperature and, after washing with wash/Perm, the cells were resuspended in 1% FCS-PBS and analyzed by cytometry of flow using a FacsCalibur (Becton Dickinson). CD3e+, CD8a+ or CD3e+ cells, CD4+ cells were pooled to determine the percentages of T cell population IFNg+ CD8+ or IFNg+ CD4+ or TNFa+ CD8+ or T TNFa+ CD4+ or IL2+ CD8+ or T IL2 CD4+ or IFNg+ TNFa+ CD8+ or TNF+ IL2+ CD8+ or IFNg CD8+ or T IFNg+ IL2+ CD4+. The percentage obtained only in the middle was considered deep. 1.2.6 IN VIVO CTL TESTS.
[0192] In vivo CTL tests were performed as described (Fournillier et al, 2007). Splenocyte suspensions were obtained from syngeneic mouse spleens and adjusted to 20 x 106 cells/ml after red blood cell lysis. One third of the cells were incubated with one of the HBV-specific peptide, the second third of the cells were incubated with another HBV peptide, all at a final concentration of 10 μM for one hour at 37 °C, where the last fraction was kept no pulse. Succinimidyl 5(6)-carboxyfluorescein diacetate ester (CFSE) (Molecular Probes, C1157) was added at 16 µM (high CFSE) to pulseless cells, at 4 µM (CFSE medium) to pulsed ILC or VLQ peptide cells and at 1 μM (low CFSE) for SFY or FLP peptide pulsed cells for ten minutes. After washing with PBS, the three populations (unpulsed cells, pulsed with peptide ILC and SLY or unpulsed cells pulsed with peptide FLP and ILC) were mixed and a total of 30.106 cells were injected into anesthetized mice via the retro-vein orbital (using ketamine-xylazine-PBS mixture (Kétamine Virbac, Centravet KET204, final concentration 25 mg/ml; Rompun Bayer xylazine hydrochloride, Centravet, final concentration 5 mg/ml)). Thus, population with low and medium CFSE represented specific targets supposedly lysed by cytotoxic T cells and population with high CFSE was an internal reference that allows the test to be normalized. Splenocytes from recipient mice were analyzed 24 hours later by flow cytometry to detect CFSE-labeled cells. After the lymphocyte meeting (SSC/FSC), a second meeting was held based on the number of events/CFSE fluorescence (FL1) which reveals three peaks, the first one corresponding to cells with low CFSE, the second to cells of CFSE medium and the third for cells with high CFSE. For each animal, the ratio between targets pulsed with CFSE+ peptide and targets not pulsed with CFSE+ (R = number of cells with low CFSE/number of cells with high CFSE) was calculated. Two crude mice were used to determine the reference R. The percentage of specific lysis for each animal was determined by the following formula: % lysis = (1 - Rmouse/R reference) x 100. The reaction was considered positive if the percentage of lysis specific to be more than 10% (cut). 2. RESULTS. 2.1 EXPRESSION OF ANTIGENS BY VIRAL VECTORS. 2.1.1 EXPRESSION OF ADTG17909 AND ADTG17910 ADENOVIRUS CONSTRUCTION ANTIGENS.
[0193] The expression of the core-env1-env2-env4 fusion protein was evaluated by means of Western Blot. A549 cells (106 cells) were infected at MOI of 10 or 50 for 48 hours with AdTG17909 or an empty adenovirus as a negative control. Cell pellets were collected and probed with an anti-mouse monoclonal antibody (C1-5, sc-23945, Santa Cruz). As shown in Figure 1A, an important band having the expected molecular weight (31.6 kDa) was revealed in the sample taken from cells infected with AdTG17909.
[0194] The expression of the polypeptide Pol* was evaluated by Western Blot after infection with AdTG17910 of A549 cells. Cell pellets were collected and then probed with a mouse anti-Pol monoclonal antibody (8D5, sc-81591, Santa Cruz). As shown in Figure 1A, a band having the expected molecular weight (88.5 kDa) was revealed in the sample collected from cells infected with AdTG17910 together with some by-products (partial polymerase proteins). 2.1.2 EXPRESSION OF MVA BUILDINGS ANTIGENS.
[0195] Analysis of the expression of Pol*, Pol*TMR, Nucleus*t, Nucleus*tEnv1, Nucleus*t-Env1-Env2 was performed by means of Western Blot. A549 or CEF cells were infected at MOI of 1 or 0.2, respectively with MVATG17842, MVATG17843, MVATG17971, MVATG17972, MVATG17993 and MVATG17994, respectively in the presence or absence of MG-132 proteasome inhibitor (10 μM) added to the culture medium for MVATG17842 and MVATG17843. After 24 hours, cells were harvested.
[0196] For MVATG17842, Western Blot analysis was performed using commercial monoclonal anti-Pol Hep B Pol antibody (8D5, Santa Cruz, n° sc-81591). As shown in Figure 1B, the expression of a protein with an apparent molecular weight of 88.5 kDa was detected only in the presence of MG-132. This band has the expected molecular weight for the Pol* protein.
[0197] For MVATG17843, Western Blot analysis was performed using commercial monoclonal anti-Pol Hep B Pol antibody (8D5, Santa Cruz, n° sc-81591). As shown in Figure 1B, the expression of a protein with an apparent molecular weight of 98.2 kDa was detected in the presence or absence of MG-132. This band has the expected molecular weight for the Pol*-TMR protein. It should be noted that, in the presence of MG132, more product and an additional product with a high molecular weight of more than 200 kDa were detected.
[0198] For MVATG17971, Western Blot analysis was performed using a commercial anti-core monoclonal antibody Hep B cAg (13A9) (Santa Cruz, no. sc-23946). As shown in Figure 1B, the expression of Nucleus* was detected with an apparent molecular weight of 21 kDa which corresponds to the expected molecular weight.
[0199] For MVATG17972, Western Blot analysis was performed using a commercial anti-core monoclonal antibody Hep B cAg (13A9) (Santa Cruz, no. sc-23946). As shown in Figure 1B, the expression of Nucleus*t was detected with an apparent molecular weight of 15.8 kDa, which corresponds to the expected molecular weight.
[0200] For MVATG17993 and MVATG17994, Western Blot analysis was performed using a commercial anti-core monoclonal antibody Hep B cAg (13A9, Santa Cruz, no. sc-23946). As shown in Figure 1B, the expression of a protein with an apparent molecular weight of 19.9 and 23.4 kDa, respectively, was detected. This band has the expected molecular weight for the Nucleus*t-Env1 and Nucleus*t-Env1-Env2 protein. 2.2 IMMUNOGENICITY OF ANTIGENS EXPRESSED FROM ADTG17909 AND ADTG17910 ADENOVIRUS VECTORS.
[0201] The immunogenicity of HBV polypeptides expressed by adenovirus vectors was determined in HLA-A2 transgenic mice immunized with AdTG17909 or AdTG17910 alone or with a mixture of the two adenoviruses. Specific T cell reactions induced after a subcutaneous injection were evaluated by means of IFNg Elispot, ICS and in vivo cytolysis tests using known HLA-A2 epitopes (described as being the target of specific T cell reactions in patients) present in domains of polymerase, core or envelope, and/or overlapping sets of peptides covering the HBV antigens of interest. 2.2.1 EVALUATION OF HBV-SPECIFIC IFNr-PRODUCING CELLS THROUGH ELISPOT TESTS.
[0202] IFNg Elispot assays have demonstrated that AdTG17910 is able to induce IFNg-producing cells specific for an HLA-A2 restricted epitope (SLYADSPSV) (SEQ ID NO. 55 located in HBV polymerase at positions 816-824) (Figure 2A ). Immunization with AdTG17909 also resulted in high frequency induction of IFNg producing cells specific for two Core HLA-A2 restricted epitopes (FLPSDFFPSV at position 18-27 (SEQ ID NO 56) and ILCWGELMTL at position 99-108 (SEQ ID No. 57), as well as for three enveloped HLA-A2 restricted epitopes (VLQAGFFLL (SEQ ID No. 58) at positions 14-22 and FLGGTTVCL (SEQ ID No. 59) at positions 41-49, both present in Env1 , and GLSPTVWLSV (SEQ ID NO:60) at positions 185-194 present in Env2) (Figure 2B and C) Immunization with the mixture of AdTG17909 and AdTG17910 also induced comparable level of specific IFNg producing cells directed to the same epitopes in the three antigens, ie the SLY epitope present on Pol, the FLP and ILC epitopes on the core protein, and the three epitopes from the envelope domains (VLQ, FLG and GLS) (Figure 2A, B and C) The frequency of cell reactions T detected after immunization with a single Ad or a mixture of both was comparable, demonstrating that there is no important immunodomination between the three antigens expressed from the vectors described. 2.2.2 EVALUATION OF HBV-SPECIFIC IFNG/TNFA-PRODUCING CELLS THROUGH INTRACELLULAR SPOT TESTS.
[0203] The number of CD8 T cells capable of producing isolated IFNg or HLA-A2-restricted epitopes directed to IFNg + TNFa present in polymerase (SLY) in central (FLP and ILC) and envelope domains (VLQ, FLG and GLS) was evaluated using the ICS test. All these epitopes were targeted by single and double secretory cells. The results are shown in Figure 3. Animals immunized with AdTG17909 alone or in combination with AdTG17910 produced nearly equivalent Center- and Env-specific CD8 T cell reactions (same percentage of specific CD8 T cells producing IFNg or IFNg + TNFa after restimulation with FLP, ILC, VLQ, FLG and GLS peptides as shown in Figures 3B and 3C).
[0204] On the other hand, regarding the polymerase-specific CD8 T cell reaction (SLY epitope), a very high percentage of CD8+ cells producing IFNg or IFNg + TNFa was detected in mice treated with AdTG1710 that express Pol* (Figure 3A), as well as those immunized with the mixture of AdTG17910 and AdTG17909 although at a lower level (Figure 3C). 2.2.3 EVALUATION OF HBV-SPECIFIC IFNG/TNFA-PRODUCING CD8 AND CD4 T CELLS AFTER IMMUNIZATION WITH A MIXTURE OF ADENOVIRUS VECTORS USING INTRACELLULAR SPOT TESTING.
[0205] The percentage of CD8 and CD4 T cells capable of producing isolated IFNg or IFNg + TNFa or IFNg + IL2 that targets HLA-A2 restricted epitopes present in polymerase (SLY) in central (FLP and ILC) and envelope domains (VLQ, FLG and GLS) or sets of overlapping peptides covering Env and core protein domains were evaluated using the ICS test. All HLA-A2-restricted epitopes tested were the target of single and double secretory cells (IFNg and IFNg + TNFa) and some sets of overlapping peptides were also the target of single and double producer cells (IFNg and IFNg + TNF and IFNg + IL2). The results are shown in Figure 4. Five HLA-A2 transgenic mice were immunized with a mixture of AdTG17909 and AdTG17910 and three HLA-A2 transgenic mice were immunized with AdTG15149 (negative control). Animals immunized with AdTG15149 did not show HBV-specific T cell reactions (data not shown). Animals immunized with AdTG17909 combined with AdTG17910 exhibited a strong HBV-directed antigen-specific CD8 T cell reaction (Figure 4A), with a high percentage of single (IFNg) and double (IFNg + TNFa) producing cells specific for the HLA-A2 epitopes present in polymerase, central and Env domains and specific to the “core 1” set of peptides and the sets of peptides covering the Env1 and Env2 domains. As illustrated in Figures 4B and 4C, these vaccinated mice also exhibited HBV antigen-specific CD4 T cell reactions, particularly single (IFNg) and double (IFNg + TNFa and IFNg + IL2) specific set of “core 2” peptide cells and the set of peptides covering Env2. 2.2.4 INDUCTION OF IN VIVO CYTOLYSIS MEASURED THROUGH IN VIVO DECTL TESTS.
[0206] The ability of AdTG17909 and AdTG17910 adenovirus vectors to induce cytolysis in vivo against cells that present HBV HLA-A2 epitopes was determined by means of in vivo CTL tests. Four HLA-A2 epitopes were tested, respectively SLY (Pol), FLP and ILC (Center) and VLQ (Env 1 domain). Six animals were immunized with a mixture of AdTG17909 + AdTG17910 and two animals were immunized with AdTG15149 (negative control). Half of each group (three mice immunized with AdTG17909 + AdTG1910 and one mouse immunized with AdTG15149) were tested to determine their ability to lyse in vivo cells pulsed with SLY peptide and cells pulsed with ILC peptide. The other half was tested to determine the ability of vaccinated animals to lyse in vivo cells pulsed with FLP peptide and cells pulsed with VLQ peptide. The results are shown in Figure 5. As expected, no HBV-specific in vivo cytolysis could be detected with mice immunized with AdTG15149 (data not shown). In vivo cytolysis against the two central epitopes FLP and ILC was weak in mice immunized with AdTG17909 + AdTG17910. On the other hand, however, animals immunized with the mixture of AdTG17909 and AdTG17910 exhibited strong in vivo cytolysis against the polymerase epitope SLY (Figure 5A) and Env1 VLQ epitope (Figure 5B), reaching more than 50% of the specific lysis in both cases .
[0207] Interestingly, the combination of Ad vectors expressing portions of pol, centro and env allows the induction of specific T cell reactions directed to the three HBV antigens when co-injected. Induced T cells are capable of producing one or two cytokines and lysing cells in vivo loaded with some HBV peptides. All together, these data demonstrate the immunogenic activity of the described compositions and their ability to induce CD8 and CD4 T cell reactions when vectored by Ad. 2.3 IMMUNOGENICITY OF ANTIGENS EXPRESSED FROM MVA VECTORS MVATG17842, MVATG17843, MVATG17971, MVATG17972, MVATG17993 AND MVATG17994.
[0208] The immunogenicity activity of the MVA-based compositions was determined in HLA-A2 transgenic mice immunized with one of the MVA vectors described in Examples 1.1.2 to 1.1.7 (MVATG17842, MVATG17843, MVATG17971 or MVATG17972 alone) or with a mixture of two MVA (MVATG17843 + MVATG17972, MVATG17843 + MVATG17993 or MVATG17843 + MVATG17994). Mice were immunized with three subcutaneous injections at an interval of one week and specific T cell reactions were evaluated by means of Elispot IFNg and ICS using the HLA-A2 epitopes described above present in the polymerase domains, center or envelope and/or sets of overlapping peptides covering the HBV antigens of interest.
[0209] 2.3.1 Evaluation of HBV-specific IFNY-producing cells by Elispot tests after immunization with polymerase expressing MVA.
[0210] Three mice were immunized with MVATG17842 which expresses a truncated and mutated polymerase antigen or MVATG17843 which expresses a membrane-directed version of the same truncated and mutated polymerase or MVA N33.1 (negative control). Polymerase-specific T cell reactions were evaluated by Elispot IFNg assays using the HLA-A2 SLY-restricted epitope and sets of peptides covering the polymerase. No HBV-specific T cell reactions were detected for mice immunized with MVA N33.1 and with MVATG17842 (data not shown). As shown in Figure 6A, however, IFNg producing cells were induced after immunization with MVATG17843 which are specific for the HLA-A2-restricted SLY epitope and the set of peptide 8 covering the C-terminal part of the polymerase (no specific reaction could be detected against the other sets of peptides 1-7 under the experimental conditions tested). These data underscore the benefit of polymerase expression as a membrane-anchored antigen at least in MVA-based compositions. 2.3.2 EVALUATION OF HBV-SPECIFIC IFNr-PRODUCING CELLS THROUGH ELISPOT THESES AFTER IMMUNIZATION WITH MVA EXPRESSING NUCLEUS:
[0211] Eight mice were immunized with MVATG17971 which expresses a central portion with residues 77-84 deleted or MVATG17972 which expresses one of its truncated versions (C-terminal truncation of residue 149) or MVA N33.1 (negative control). Center-specific T cell reactions were determined by IFNg Elispot assays using HLA-A2 restricted epitopes (FLP and ILC peptides) and the center 1 and center 2 peptide sets described above. As illustrated in Figure 6B, immunization with MVA TG17971 is capable of inducing specific sporadic T cell reactions against HLA-A2-restricted ILC and FLP peptides and the cluster of two peptides covering core antigen (Figure 6B). No center-specific T cell reactions could be detected in mice immunized with MVATG17972 using the tested peptides and under the experimental conditions tested (data not shown). 2.3.3 EVALUATION OF HBV-SPECIFIC IFNr-PRODUCING CELLS THROUGH ELISPOT TESTS AFTER IMMUNIZATION WITH MVA VECTOR COMBINATION.
[0212] Three mice were immunized with a mixture of MVA TG17843 and MVA TG17972, MVA TG17993 and MVA TG17994 and HBV-specific T cell reactions were evaluated by means of the IFNg Elispot test using the peptides described above.
[0213] Polymerase-specific T cell reactions were detected in the vast majority of animals vaccinated with the combination of MVATG17843 + MVATG17972 (positive reactions in 2/3 animals as shown in Figure 7A), MVATG17843 + MVATG17993 (positive reactions in 3/3 animals as shown in Figure 7B) and MVATG17843 + MVATG17994 (positive reactions in 2/3 animals as shown in Figure 7C). The frequency of IFNg-producing cells is apparently comparable to that observed during the injection of MVATG17843 alone (Figure 6A), which demonstrates that the combination of vectors is not harmful to the induced immune reaction.
[0214] No site-specific reactions could be detected under the experimental conditions tested in any of the animals vaccinated using HLA-A2 or peptide sets (data not shown).
[0215] No specific env reaction could be detected under the experimental conditions tested in any of the animals vaccinated with the combination comprising MVATG17993 using HLA-A2 Env1 or peptide sets (data not shown).
[0216] Env 2 specific T cell reactions were detected in two out of three animals immunized with the combination comprising MVATG17994 as illustrated in Figure 7C which were directed against the HLA-A2 restricted GLS epitope and the set of peptides covering Env2 (No detection of T cell reactions against the Env1 domain could be observed under these experimental conditions; data not shown).
[0217] ICS tests performed under the same conditions confirmed the results observed in Elispot tests (data not shown).
[0218] Interestingly, the combination of MVA vectors that express portions of pol, center and env allows the induction of specific T cell reactions directed to the pol and env2 antigens when co-injected.
[0219] Taken together, these data demonstrate the immunogenic activity of the described compositions and their ability to induce T cell reactions against major HBV antigens.

权利要求:
Claims (31)
[0001]
1. IMMUNOGENIC COMPOSITION, characterized in that it comprises a combination of three polypeptides, wherein said polypeptides are: (i) a polymerase portion comprising at least 450 amino acid residues of a polymerase protein originating from a first HBV virus, wherein said polymerase portion comprises an amino acid sequence having the amino acid sequence selected from the group consisting of: - amino acid sequence shown in SEQ ID NO:7, - amino acid sequence shown in SEQ ID NO:8, - amino acid sequence shown in SEQ ID NO:7 with replacement of the Asp residue at position 494 by a His residue and/or the replacement of the Glu residue at position 672 by a His residue, - amino acid sequence shown in SEQ ID NO:9 , - amino acid sequence shown in SEQ ID NO:1 or part thereof comprising at least 450 amino acid residues, and - amino acid sequence shown in SEQ ID NO:1 or part thereof comprising at least 450 amino acid residues, with the substitution of the Asp residue at position 540 for a His residue and/or the substitution of the Glu residue at position 718 for a His residue; (ii) a core portion comprising at least 100 amino acid residues of a core protein originating from a second HBV virus, said core portion comprising an amino acid sequence having the amino acid sequence shown in SEQ ID NO: 10 or in SEQ ID NO: 11; and (iii) an env portion comprising one or more immunogenic domain(s) from 20 to 100 consecutive amino acid residues of an HBsAg protein originating from a third HBV virus, wherein the immunogenic domain(s) comprise(s) ) an amino acid sequence having any of the amino acid sequences shown in SEQ ID NO: 12 to 15, or wherein said env portion comprises an amino acid sequence having the amino acid sequence shown in SEQ ID NO: 16 or in SEQ ID NO: 17.
[0002]
2. COMPOSITION according to claim 1, characterized in that the mentioned first, second and third HBV viruses are of different genotypes.
[0003]
3. COMPOSITION according to claim 1, characterized in that at least two among the mentioned first, second and third HBV viruses are of the same HBV genotype and, preferably, the mentioned first, second and third HBV viruses are of the same genotype.
[0004]
4. COMPOSITION according to claim 3, characterized in that the mentioned first, second and third HBV viruses are of genotype D and preferably of HBV isolate Y07587.
[0005]
5. COMPOSITION according to claim 3, characterized in that said first, second and third HBV viruses are of genotypes B or C.
[0006]
A COMPOSITION according to any one of claims 1 to 5, characterized in that said polymerase portion is modified by truncating at least 20 amino acid residues and at most 335 amino acid residues normally present at the N-terminus of a native HBV polymerase, and preferably the first 47 or 46 amino acid residues after the initiating Met residue located at the N-terminus of a native HBV polymerase.
[0007]
A COMPOSITION according to any one of claims 1 to 6, characterized in that said polymerase portion is fused in frame to a heterologous hydrophobic sequence, and preferably in frame to the transmembrane and signal peptides of the rabies glycoprotein, wherein said rabies signal sequence is fused in frame at the N-terminus and said rabies transmembrane sequence is fused in frame at the C-terminus of said polymerase moiety.
[0008]
8. COMPOSITION according to any one of claims 1 to 7, characterized in that said polymerase, central and/or env portions are fused in frame into a single polypeptide chain in pairs or all together.
[0009]
A COMPOSITION according to claim 8, characterized in that said env portion is fused in frame to the C-terminal of said central portion.
[0010]
10. COMPOSITION according to claim 9, characterized in that said fusion polypeptide of the central portion with the env portion is selected from the group consisting of: - a polypeptide comprising an amino acid sequence having the displayed amino acid sequence in SEQ ID No. 18; - a polypeptide comprising an amino acid sequence having the amino acid sequence shown in SEQ ID N° 19; and - a polypeptide comprising an amino acid sequence having the amino acid sequence shown in SEQ ID N° 20 or the part of the amino acid sequence shown in SEQ ID N° 20 starting at residue 1 and ending at residue 251 or, alternatively , the portion of the amino acid sequence shown in SEQ ID No. 20 that begins at residue 1 and ends at residue 221; or its deleted versions that do not contain residues 77 to 84 in SEQ ID NO: 20.
[0011]
A COMPOSITION according to any one of claims 1 to 10, characterized in that it comprises a vector encoding the polymerase portion, the central portion and the env portion, as defined in any one of claims 1 to 10, or a combination of at least two independent vectors encoding the polymerase portion, the core portion and the env portion as defined in any one of claims 1 to 10.
[0012]
12. NUCLEIC ACID MOLECULE, characterized in that it encodes a combination of the polymerase portion as defined in any one of claims 1 and 6 to 7, the central portion as defined in claim 1, and the env portion as defined in any one of claims 1 and 8 to 10, or combinations thereof, wherein said nucleic acid molecule is selected from the group consisting of: - a nucleic acid molecule comprising a nucleotide sequence having the nucleotide sequence shown in SEQ ID NO. 21; - a nucleic acid molecule comprising a nucleotide sequence having the nucleotide sequence shown in SEQ ID No. 22; - a nucleic acid molecule comprising a nucleotide sequence having the nucleotide sequence shown in SEQ ID No. 21 with the replacement of the nucleotide G at position 1480 by a C, the nucleotide G at position 2014 by a C, and the nucleotide A in the 2016 position by a T; - a nucleic acid molecule comprising a nucleotide sequence having the nucleotide sequence shown in SEQ ID No. 23; - a nucleic acid molecule comprising a nucleotide sequence having the nucleotide sequence shown in SEQ ID No. 24; - a nucleic acid molecule comprising a nucleotide sequence having the nucleotide sequence shown in SEQ ID No. 25; and - a nucleic acid molecule comprising a nucleotide sequence having the nucleotide sequence shown in SEQ ID No. 26 or the part of the nucleotide sequence shown in SEQ ID No. 26 starting at nucleotide 1 and ending at nucleotide 753 or the part of the nucleotide sequence shown in SEQ ID No. 26 starting at nucleotide 1 and ending at nucleotide 663 or its deleted versions that do not contain the part extending from the G at position 229 to the A at position 252 of SEQ ID NO: 26.
[0013]
13. VECTOR, viral or plasmid, characterized in that it comprises one or more nucleic acid molecules, as defined in claim 12.
[0014]
14. VECTOR according to claim 13, characterized in that said viral vector is an adenoviral vector with a replication defect, and preferably an adenoviral vector comprising said inserted nucleic acid molecule(s) ) in place of the E1 region.
[0015]
15. VECTOR according to claim 13, characterized in that said viral vector is a poxvirus vector, more specifically obtained from canary pox, bird pox or vaccinia virus, wherein said vaccinia virus is preferably from the Ankara lineage modified (MVA).
[0016]
16. VECTOR according to any one of claims 13 to 15, characterized in that said vector is selected from the group consisting of: (i) an MVA vector comprising a nucleic acid molecule placed under the control of a promoter vaccinia such as the 7.5K promoter and encoding a polymerase portion comprising an amino acid sequence as shown in SEQ ID NO. 7, 8 or 9 or in SEQ ID NO. 7 with the Asp residue substitution at position 494 by a His residue and the replacement of the Glu residue at position 672 by a His residue; (ii) an MVA vector which comprises a nucleic acid molecule placed under the control of a vaccinia promoter such as the pH5r promoter and which encodes a central portion and an env portion which comprises an amino acid sequence as shown in SEQ ID NO. 18 or 19; (iii) an E1 defective Ad vector comprising, inserted in place of the E1 region, a nucleic acid molecule placed under the control of the CMV promoter and encoding a polymerase portion comprising an amino acid sequence as shown in SEQ ID No. 7, 8 or 9 or in SEQ ID No. 7 with the replacement of the Asp residue at position 494 by a His residue and the replacement of the Glu residue at position 672 by a His residue; and (iv) an E1 defective Ad vector comprising, inserted in place of the E1 region, a nucleic acid molecule placed under the control of the CMV promoter and encoding a central portion and an env portion comprising a conforming amino acid sequence shown in SEQ ID No. 18, 19, or 20 or the portion of SEQ ID No. 20 that begins at residue 1 and ends at residue 251 or in the portion of SEQ ID No. 20 that begins at residue 1 and ends at residue 221.
[0017]
17. INFECTIOUS VIRAL PARTICLE, characterized in that it comprises the nucleic acid molecule, as defined in claim 12, or the vector, as defined in any one of claims 13 to 16.
[0018]
18. PARTICLE according to claim 17, characterized in that said infectious viral particles are produced by means of a process comprising the steps of: a. introducing the nucleic acid molecule as defined in claim 12, or the vector as defined in any one of claims 13 to 16, into an appropriate cell lineage; B. culturing said cell line under appropriate conditions so as to permit the production of said infectious viral particle; ç. recovery of the infectious viral particle produced from the culture of said cell lineage; and d. optional purification of said recovered infectious viral particle.
[0019]
19. TRANSGENIC MICROORGANISM, characterized in that it comprises the nucleic acid molecule as defined in claim 12, the vector as defined in any one of claims 13 to 16, or the infectious viral particle as defined in any one of claims 17 to 18.
[0020]
20. COMPOSITION, characterized in that it comprises the nucleic acid molecule as defined in claim 12, the vector as defined in any one of claims 13 to 16, or the infectious viral particle as defined in any one of claims 17 to 18, or the transgenic microorganism as defined in claim 19 and a pharmaceutically acceptable carrier.
[0021]
21. COMPOSITION according to claim 20, characterized in that it additionally comprises one or more adjuvants suitable for systemic or mucosal application in humans.
[0022]
22. COMPOSITION according to any one of claims 20 to 21, characterized in that it is formulated for intramuscular or subcutaneous administration.
[0023]
A COMPOSITION according to any one of claims 20 to 22, characterized in that it comprises from 105 to 1013 infection units of a viral vector or an infectious viral particle.
[0024]
24. USE OF THE IMMUNOGENIC COMPOSITION, as defined in any one of claims 1 to 11, of the nucleic acid molecule as defined in claim 12, of the vector, as defined in any one of claims 13 to 16, of the infectious viral particle, as defined in defined in any one of claims 17 to 18, the transgenic microorganism as defined in claim 19, or the composition as defined in any one of claims 20 to 23, characterized in that it is for the preparation of a drug intended for the treatment or prevention of a HBV infection or a disease or pathological condition associated with HBV, and preferably a drug intended for the treatment of patients with chronic hepatitis B viral infection.
[0025]
25. USE according to claim 24, characterized in that said use is employed in combination with a standard of care and, preferably, a standard of care comprising cytokines and/or nucleotide or nucleoside analogues selected from the group consisting of lamivudine, entecavir, telbivudine, adefovir, dipivoxil and tenofovir.
[0026]
26. USE OF THE IMMUNOGENIC COMPOSITION, as defined in any one of claims 1 to 11, of the nucleic acid molecule as defined in claim 12, of the vector, as defined in any one of claims 13 to 16, of the infectious viral particle, as defined in defined in any one of claims 17 to 18, the transgenic microorganism as defined in claim 19, or the composition as defined in any one of claims 20 to 23, characterized in that it is for the preparation of a drug intended for induction or stimulation of an immune reaction, preferably a CD4+ and/or CD8+ mediated cellular reaction against HBV in a host organism.
[0027]
27. KIT OF PARTS, for use in the treatment of HBV infections, characterized in that said kit comprises active agents selected from the group consisting of the immunogenic composition, as defined in any one of claims 1 to 11, in the nucleic acid molecule, as defined in claim 12, in the vector as defined in any one of claims 13 to 16, in the infectious viral particle as defined in any one of claims 17 to 18, in the transgenic microorganism as defined in claim 19, or in the composition as defined in any one of claims 20 to 23.
[0028]
28. KIT according to claim 27, characterized in that it comprises a first vector comprising a nucleic acid molecule encoding the polymerase moiety as defined in any one of claims 1 and 6 to 7, and a second vector comprising a nucleic acid molecule encoding the core portion and/or the env portion as defined in any one of claims 1 and 8 to 10.
[0029]
A kit according to claim 28, characterized in that said first vector is an MVA vector as defined in claim 16(i) and said second vector is an MVA vector as defined in claim 16(ii).
[0030]
KIT according to claim 28, characterized in that said first vector is an Ad vector as defined in claim 16(iii) and said second vector is an Ad vector as defined in claim 16(iv).
[0031]
31. KIT according to any one of claims 28 to 30, characterized in that it further comprises a third vector that expresses an immunomodulator.

类似技术:

---

公开号 | 公开日 | 专利标题

---

JP6246778B2|2017-12-13|Composition for treating HBV infection

---

US10662414B2|2020-05-26|Methods for treating or preventing HBV infection or HBV related diseases

---

US10857226B2|2020-12-08|Composition for treating HBV infection

---

BR112014000627B1|2021-12-14|MUTANT POLYPEPTIDE, FUSION PROTEINS, NUCLEIC ACID MOLECULE, VECTOR, VECTOR PRODUCTION PROCESS, HOST CELL, PROCESS FOR RECOMBINANT PRODUCTION, COMPOSITION AND KIT

---

NZ620867B2|2016-05-27|Hbv polymerase mutants

同族专利:

---

公开号 | 公开日

---

HK1223295A1|2017-07-28|

---

TW201106967A|2011-03-01|

---

BR112012002628A2|2016-11-08|

---

AU2010280710A1|2012-03-01|

---

IL217926D0|2012-03-29|

---

MX2012001592A|2012-05-22|

---

JP2013501038A|2013-01-10|

---

NZ598000A|2013-10-25|

---

JP2016074707A|2016-05-12|

---

EP2461826A2|2012-06-13|

---

RU2555346C2|2015-07-10|

---

CA2770075C|2021-08-24|

---

KR20120052352A|2012-05-23|

---

WO2011015656A3|2011-03-31|

---

CA2770075A1|2011-02-10|

---

ZA201200899B|2012-10-31|

---

JP5897464B2|2016-03-30|

---

CN102573903B|2015-12-02|

---

SG178254A1|2012-03-29|

---

RU2012107671A|2013-09-20|

---

CN102573903A|2012-07-11|

---

WO2011015656A2|2011-02-10|

---

TWI555531B|2016-11-01|

---

IL217926A|2016-07-31|

---

JP6246778B2|2017-12-13|

---

CN105535960A|2016-05-04|

---

US9393299B2|2016-07-19|

---

CN105535960B|2019-06-04|

---

US20170072047A1|2017-03-16|

---

US20130011435A1|2013-01-10|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US4711955A|1981-04-17|1987-12-08|Yale University|Modified nucleotides and methods of preparing and using same|

---

CA1223831A|1982-06-23|1987-07-07|Dean Engelhardt|Modified nucleotides, methods of preparing andutilizing and compositions containing the same|

---

FR2583429B1|1985-06-18|1989-11-03|Transgene Sa|INTERFERON U EXPRESSION VECTOR IN MAMMALIAN CELLS, PROCESS FOR IMPLEMENTING SAME AND PRODUCT OBTAINED, AND PHARMACEUTICAL COMPOSITION CONTAINING INTERFERON U|

---

FR2650838A1|1989-08-09|1991-02-15|Transgene Sa|FACTOR IX EXPRESSION VECTORS IN A SUPERIOR EUKARYOTE CELL, PROCESS FOR THE PREPARATION OF FACTOR IX BY TRANSGENIC ANIMALS, AND FACTOR IX OBTAINED|

---

NZ235315A|1989-09-19|1991-09-25|Wellcome Found|Chimaeric hepadnavirus core antigen proteins and their construction|

---

EP0491077A1|1990-12-19|1992-06-24|Medeva Holdings B.V.|A composition used as a therapeutic agent against chronic viral hepatic diseases|

---

NZ244103A|1991-08-26|1997-07-27|Cytel Corp|Peptides which induce mhc class i restricted ctl responses against hbv antigens and their use|

---

US6013638A|1991-10-02|2000-01-11|The United States Of America As Represented By The Department Of Health And Human Services|Adenovirus comprising deletions on the E1A, E1B and E3 regions for transfer of genes to the lung|

---

GB9223084D0|1992-11-04|1992-12-16|Imp Cancer Res Tech|Compounds to target cells|

---

ES2204912T3|1993-02-26|2004-05-01|The Scripps Research Institute|PEPTIDES THAT INDUCE RESPONSES OF CYTOTOXIC T-LYMPHOCYTES AGAINST THE VIRUS OF HEPATITIS B.|

---

US6133028A|1993-05-28|2000-10-17|Transgene S.A.|Defective adenoviruses and corresponding complementation lines|

---

FR2705686B1|1993-05-28|1995-08-18|Transgene Sa|New defective adenoviruses and corresponding complementation lines.|

---

DE69434447T2|1993-06-07|2006-05-18|Vical, Inc., San Diego|PLASMIDE FOR GENE THERAPY|

---

US5525711A|1994-05-18|1996-06-11|The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services|Pteridine nucleotide analogs as fluorescent DNA probes|

---

FR2727689B1|1994-12-01|1997-02-28|

---

US5837520A|1995-03-07|1998-11-17|Canji, Inc.|Method of purification of viral vectors|

---

JP4051416B2|1995-06-15|2008-02-27|クルーセルホランドベスローテンフェンノートシャップ|Packaging system for human recombinant adenovirus used in gene therapy|

---

EP0833668A4|1995-06-20|2001-12-12|Gen Hospital Corp|Inhibition of hepatitis b replication|

---

EE04753B1|1995-07-04|2006-12-15|GSF-Forschungszentrum für Umwelt und Gesundheit GmbH|Recombinant MVA virus and its use, isolated eukaryotic cell, method for producing recombinant hTyr protein and vaccine|

---

KR20050043996A|1996-07-01|2005-05-11|아방티 파르마 소시에테 아노님|Method for producing recombinant adenovirus|

---

US5981274A|1996-09-18|1999-11-09|Tyrrell; D. Lorne J.|Recombinant hepatitis virus vectors|

---

AT550429T|1996-11-20|2012-04-15|Crucell Holland Bv|ADENOVIRUS COMPOSITIONS AVAILABLE THROUGH AN IMPROVED PRODUCTION AND PURIFICATION PROCESS|

---

DE69739961D1|1996-12-13|2010-09-23|Schering Corp|Methods for virus cleaning|

---

EP0988053A1|1997-06-11|2000-03-29|Aquila Biopharmaceuticals, Inc.|Purified saponins as oral adjuvants|

---

FR2766091A1|1997-07-18|1999-01-22|Transgene Sa|ANTITUMOR COMPOSITION BASED ON MODIFIED IMMUNOGENIC POLYPEPTIDE WITH CELL LOCATION|

---

US6596501B2|1998-02-23|2003-07-22|Fred Hutchinson Cancer Research Center|Method of diagnosing autoimmune disease|

---

FR2777570A1|1998-04-17|1999-10-22|Transgene Sa|Novel mutant enzyme and related fusion proteins, useful for gene therapy of cancer, by prodrug activation|

---

JP3864610B2|1998-05-21|2007-01-10|旭硝子株式会社|Water-dispersed water / oil repellent composition and method for producing the same|

---

SK7602001A3|1998-12-04|2002-03-05|Biogen Inc|Hbv core antigen particles with multiple immunogenic components attached via peptide ligands|

---

FR2787465A1|1998-12-21|2000-06-23|Transgene Sa|PROCESS FOR INACTIVATION OF ENVELOPED VIRUSES IN VIRUS PREPARATION OF NON-ENVELOPED VIRUSES|

---

IL143381D0|1998-12-31|2002-04-21|Aventis Pharma Sa|Method for separating viral particles|

---

AU774437B2|1999-02-22|2004-06-24|Transgene S.A.|Method for obtaining a purified viral preparation|

---

IL146479D0|1999-05-17|2002-07-25|Crucell Holland Bv|Adenovirus derived gene delivery vehicles comprising at least one element of adenovirus type 35|

---

US6492169B1|1999-05-18|2002-12-10|Crucell Holland, B.V.|Complementing cell lines|

---

FR2803599B1|2000-01-06|2004-11-19|Inst Nat Sante Rech Med|NEW MUTATED HEPATITIS B VIRUS, ITS NUCLEIC AND PROTEIN CONSTITUENTS AND THEIR APPLICATIONS|

---

CA2341356C|2000-04-14|2011-10-11|Transgene S.A.|Poxvirus with targeted infection specificity|

---

EP1278542A2|2000-05-05|2003-01-29|Cytos Biotechnology AG|Molecular antigen arrays and vaccines|

---

US6858590B2|2000-08-17|2005-02-22|Tripep Ab|Vaccines containing ribavirin and methods of use thereof|

---

CA2448908C|2001-05-30|2008-03-18|Transgene S.A.|Adenovirus protein ix, its domains involved in capsid assembly, transcriptional activity and nuclear reorganization|

---

US7351413B2|2002-02-21|2008-04-01|Lorantis, Limited|Stabilized HBc chimer particles as immunogens for chronic hepatitis|

---

EP1476543B1|2002-02-07|2014-05-14|Melbourne Health|Viral variants with altered susceptibility to nucleoside analogs and uses thereof|

---

DE60323080D1|2002-04-25|2008-10-02|Crucell Holland Bv|STABLE ADENOVIRAL VECTORS AND METHODS FOR THEIR REPRODUCTION|

---

CA2518926A1|2003-03-17|2004-09-30|Merck & Co., Inc.|Adenovirus serotype 24 vectors, nucleic acids and virus produced thereby|

---

US20040191222A1|2003-03-28|2004-09-30|Emini Emilio A.|Adenovirus serotype 34 vectors, nucleic acids and virus produced thereby|

---

FR2855758B1|2003-06-05|2005-07-22|Biomerieux Sa|COMPOSITION COMPRISING NS3 / NS4 POLYPROTEIN AND HCV NS5B POLYPEPTIDE, EXPRESSION VECTORS INCLUDING THE CORRESPONDING NUCLEIC SEQUENCES AND THEIR USE IN THERAPEUTICS|

---

US7695960B2|2003-06-05|2010-04-13|Transgene S.A.|Composition comprising the polyprotein NS3/NS4 and the polypeptide NS5B of HCV, expression vectors including the corresponding nucleic sequences and their therapeutic use|

---

WO2004113370A1|2003-06-20|2004-12-29|Dade Behring Marburg Gmbh|Novel surface protein variant of hepatitis b virus|

---

JP2007530004A|2003-07-18|2007-11-01|オニックスファーマシューティカルズ，インコーポレイティド|Subgroup B adenoviral vectors for treating diseases|

---

ES2356154T3|2003-07-21|2011-04-05|Transgene S.A.|MULTIFUNCTIONAL CYTOKINS.|

---

US8007805B2|2003-08-08|2011-08-30|Paladin Labs, Inc.|Chimeric antigens for breaking host tolerance to foreign antigens|

---

DE10339927A1|2003-08-29|2005-03-24|Rhein Biotech Gesellschaft für neue Biotechnologische Prozesse und Produkte mbH|Composition for the prophylaxis / therapy of HBV infections and HBV-mediated diseases|

---

JP2007509614A|2003-10-21|2007-04-19|メルボルンヘルス|Detection and application of HBV variants|

---

GB0328753D0|2003-12-11|2004-01-14|Royal Veterinary College The|Hepatitis B vaccines|

---

EP1814907B1|2004-11-08|2009-01-21|Transgene S.A.|Kit of parts designed for implementing an antitumoral or antiviral treatment in a mammal|

---

EP1764369A1|2005-09-16|2007-03-21|Rhein Biotech Gesellschaft für neue biotechnologische Prozesse und Produkte mbH|Vaccines comprising truncated HBC core protein plus saponin-based adjuvant|

---

GB0522578D0|2005-11-04|2005-12-14|King S College London|Ribozymal nucleic acid|

---

JP5188400B2|2006-03-09|2013-04-24|トランスジーンエス．エー．|Nonstructural fusion protein of hepatitis C virus|

---

CA2656266C|2006-06-20|2012-07-31|Transgene S.A.|Recombinant viral vaccine|

---

CN101573449B|2006-08-14|2013-09-18|浦项工大产学协力团|A DNA vaccine for curing chronic hepatitis b and a method of preparing same|

---

AU2008250520B2|2007-05-15|2013-10-31|Transgene S.A.|Vectors for multiple gene expression|

---

ES2847288T3|2008-01-25|2021-08-02|Univ Heidelberg Ruprecht Karls|Modified hydrophobic preS derived peptides of hepatitis B virus and their use as vehicles for specific delivery of compounds to the liver|

---

SG178254A1|2009-08-07|2012-03-29|Transgene Sa|Composition for treating hbv infection|

---

US10076570B2|2009-08-07|2018-09-18|Transgene S.A.|Composition for treating HBV infection|SG178254A1|2009-08-07|2012-03-29|Transgene Sa|Composition for treating hbv infection|

---

CA2838950C|2011-06-14|2020-10-27|Globeimmune, Inc.|Yeast-based compositions and methods for the treatment or prevention of hepatitis delta virus infection|

---

TWI623618B|2011-07-12|2018-05-11|傳斯堅公司|Hbv polymerase mutants|

---

WO2014009433A1|2012-07-10|2014-01-16|Transgene Sa|Mycobacterium resuscitation promoting factor for use as adjuvant|

---

TWI690322B|2012-10-02|2020-04-11|法商傳斯堅公司|Virus-containing formulation and use thereof|

---

US9946495B2|2013-04-25|2018-04-17|Microsoft Technology Licensing, Llc|Dirty data management for hybrid drives|

---

WO2016020538A1|2014-08-08|2016-02-11|Transgene Sa|Hbv vaccine and antibody combination therapy to treat hbv infections|

---

WO2016131945A1|2015-02-20|2016-08-25|Transgene Sa|Combination product with autophagy modulator|

---

AU2016232771B2|2015-03-18|2021-08-19|Omnicyte|Fusion proteins comprising modified alpha virus surface glycoproteins and tumor associated antigen and methods thereof|

---

CN106148404B|2015-03-25|2020-01-24|复旦大学|Human hepatitis B virus recombinant vector and application thereof|

---

WO2016167369A1|2015-04-16|2016-10-20|国立研究開発法人産業技術総合研究所|Inhibitor of hepatitis b virus secretion|

---

CN108779472A|2015-11-04|2018-11-09|霍欧奇帕生物科技股份公司|For the vaccine of hepatitis type B virus|

---

CA3003548A1|2015-11-12|2017-05-18|Hookipa Biotech Ag|Arenavirus particles as cancer vaccines|

---

US9963751B2|2015-11-24|2018-05-08|The Penn State Research Foundation|Compositions and methods for identifying agents to reduce hepatitis B virus covalently closed circular DNA|

---

WO2017210181A1|2016-05-30|2017-12-07|Geovax Inc.|Compositions and methods for generating an immune response to hepatitis b virus|

---

MX2018015629A|2016-06-15|2019-09-26|Univ Oxford Innovation Ltd|Dual overlapping adeno-associated viral vector system for expressing abc4a.|

---

WO2018069316A2|2016-10-10|2018-04-19|Transgene Sa|Immunotherapeutic product and mdsc modulator combination therapy|

---

GB201705765D0|2017-04-10|2017-05-24|Univ Oxford Innovation Ltd|HBV vaccine|

---

AU2018270375A1|2017-05-15|2019-10-31|Bavarian Nordic A/S|Stable virus-containing composition|

---

CN110603058A|2017-05-15|2019-12-20|扬森疫苗与预防公司|Stable compositions comprising viruses|

---

GB201721069D0|2017-12-15|2018-01-31|Glaxosmithkline Biologicals Sa|Hepatitis B Immunisation regimen and compositions|

---

WO2019123250A1|2017-12-19|2019-06-27|Janssen Sciences Ireland Unlimited Company|Methods and compositions for inducing an immune response against hepatitis b virus |

---

US11020476B2|2017-12-19|2021-06-01|Janssen Sciences Ireland Unlimited Company|Methods and compositions for inducing an immune response against Hepatitis B Virus |

---

EA202091513A1|2017-12-19|2020-09-09|Янссен Сайенсиз Айрлэнд Анлимитед Компани|VACCINES AGAINST HEPATITIS B VIRUSAND THEIR APPLICATION|

---

MA51292A|2017-12-19|2020-10-28|Ichor Medical Systems Inc|METHODS AND APPARATUS FOR GIVING VACCINES AGAINST THE HEPATITIS B VIRUS |

---

KR20200111729A|2018-01-19|2020-09-29|얀센 파마슈티칼즈, 인코포레이티드|Induction and enhancement of immune response using recombinant replicon system|

---

KR102234027B1|2018-05-09|2021-03-31|서울대학교산학협력단|Hepatitis b virus-derived polypeptide and use thereof|

---

WO2021045969A1|2019-08-29|2021-03-11|Vir Biotechnology, Inc.|Hepatitis b virus vaccines|

---

WO2021067181A1|2019-09-30|2021-04-08|Gilead Sciences, Inc.|Hbv vaccines and methods treating hbv|

---

WO2021110919A1|2019-12-07|2021-06-10|Isa Pharmaceuticals|Treatment of diseases related to hepatitis b virus|

法律状态:
2018-04-10| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-11-12| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|Free format text: DE ACORDO COM O ARTIGO 229-C DA LEI NO 10196/2001, QUE MODIFICOU A LEI NO 9279/96, A CONCESSAO DA PATENTE ESTA CONDICIONADA A ANUENCIA PREVIA DA ANVISA. CONSIDERANDO A APROVACAO DOS TERMOS DO PARECER NO 337/PGF/EA/2010, BEM COMO A PORTARIA INTERMINISTERIAL NO 1065 DE 24/05/2012, ENCAMINHA-SE O PRESENTE PEDIDO PARA AS PROVIDENCIAS CABIVEIS. |

---

2020-10-20| B07E| Notification of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|

---

2020-11-10| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2021-03-16| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|

---

2021-07-13| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-09-08| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 06/08/2010, OBSERVADAS AS CONDICOES LEGAIS. PATENTE CONCEDIDA CONFORME ADI 5.529/DF, QUE DETERMINA A ALTERACAO DO PRAZO DE CONCESSAO. |

优先权:

---

申请号 | 申请日 | 专利标题

---

EP09305742.0|2009-08-07|

---

EP09305742|2009-08-07|

---

PCT/EP2010/061492|WO2011015656A2|2009-08-07|2010-08-06|Composition for treating hbv infection|

---